Incidental Mutation 'R7158:Coq8a'
ID557415
Institutional Source Beutler Lab
Gene Symbol Coq8a
Ensembl Gene ENSMUSG00000026489
Gene Namecoenzyme Q8A
Synonyms4632432J16Rik, Cabc1, Adck3
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.717) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location180165238-180199602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180179184 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 93 (D93G)
Ref Sequence ENSEMBL: ENSMUSP00000027766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027766] [ENSMUST00000159914] [ENSMUST00000160102] [ENSMUST00000160121] [ENSMUST00000160169] [ENSMUST00000160482] [ENSMUST00000160879] [ENSMUST00000161300] [ENSMUST00000161379] [ENSMUST00000161632] [ENSMUST00000161743] [ENSMUST00000161746] [ENSMUST00000161814] [ENSMUST00000162725] [ENSMUST00000162769] [ENSMUST00000170472]
Predicted Effect probably benign
Transcript: ENSMUST00000027766
AA Change: D93G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027766
Gene: ENSMUSG00000026489
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159914
AA Change: D93G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123720
Gene: ENSMUSG00000026489
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160102
SMART Domains Protein: ENSMUSP00000124289
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160121
SMART Domains Protein: ENSMUSP00000124208
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160169
AA Change: D93G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125089
Gene: ENSMUSG00000026489
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160482
AA Change: D93G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124329
Gene: ENSMUSG00000026489
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160879
SMART Domains Protein: ENSMUSP00000141948
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161300
SMART Domains Protein: ENSMUSP00000125002
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:ABC1 93 187 5.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161379
Predicted Effect probably benign
Transcript: ENSMUST00000161632
AA Change: D46G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124481
Gene: ENSMUSG00000026489
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 44 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161743
SMART Domains Protein: ENSMUSP00000123905
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161746
Predicted Effect probably benign
Transcript: ENSMUST00000161814
AA Change: D93G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125071
Gene: ENSMUSG00000026489
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162725
AA Change: D93G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125024
Gene: ENSMUSG00000026489
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162769
Predicted Effect probably benign
Transcript: ENSMUST00000170472
AA Change: D93G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128290
Gene: ENSMUSG00000026489
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Coq8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Coq8a APN 1 180168389 missense probably benign 0.11
IGL01797:Coq8a APN 1 180169719 splice site probably null
IGL01873:Coq8a APN 1 180178977 missense probably damaging 1.00
R1148:Coq8a UTSW 1 180169403 splice site probably benign
R1421:Coq8a UTSW 1 180170441 splice site probably benign
R1743:Coq8a UTSW 1 180182229 missense probably benign 0.14
R4678:Coq8a UTSW 1 180170081 missense probably damaging 0.99
R4827:Coq8a UTSW 1 180167338 missense possibly damaging 0.46
R4904:Coq8a UTSW 1 180178603 missense probably damaging 1.00
R5716:Coq8a UTSW 1 180179260 missense possibly damaging 0.94
R5769:Coq8a UTSW 1 180179116 missense probably damaging 1.00
R6636:Coq8a UTSW 1 180178987 missense probably benign 0.00
R6991:Coq8a UTSW 1 180179068 missense probably benign 0.00
R7125:Coq8a UTSW 1 180168801 missense probably damaging 1.00
R7161:Coq8a UTSW 1 180170341 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTTCGCTGGATGCCGTTG -3'
(R):5'- TCTTAGGCAGCATCCTTTGGAG -3'

Sequencing Primer
(F):5'- TGGCCAAGAACAAGTCTCTGTGATC -3'
(R):5'- CAGCATCCTTTGGAGGGTTAGAGAG -3'
Posted On2019-06-26