Incidental Mutation 'R7158:Mtmr9'
ID557465
Institutional Source Beutler Lab
Gene Symbol Mtmr9
Ensembl Gene ENSMUSG00000035078
Gene Namemyotubularin related protein 9
SynonymsMTMR8, 9430075G12Rik, mMTMH3, LIP-STYX
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location63519651-63543982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63526869 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 470 (F470L)
Ref Sequence ENSEMBL: ENSMUSP00000059894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058679]
Predicted Effect probably benign
Transcript: ENSMUST00000058679
AA Change: F470L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059894
Gene: ENSMUSG00000035078
AA Change: F470L

DomainStartEndE-ValueType
Pfam:Myotub-related 108 446 2.2e-133 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myotubularin-related protein that is atypical to most other members of the myotubularin-related protein family because it has no dual-specificity phosphatase domain. The encoded protein contains a double-helical motif similar to the SET interaction domain, which is thought to have a role in the control of cell proliferation. In mouse, a protein similar to the encoded protein binds with MTMR7, and together they dephosphorylate phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Mtmr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Mtmr9 APN 14 63543497 missense probably damaging 1.00
IGL01309:Mtmr9 APN 14 63526805 missense probably damaging 1.00
IGL01999:Mtmr9 APN 14 63542454 missense probably damaging 1.00
IGL02164:Mtmr9 APN 14 63530288 missense probably damaging 0.98
IGL02276:Mtmr9 APN 14 63530276 missense probably damaging 1.00
IGL02868:Mtmr9 APN 14 63524139 missense probably benign 0.41
IGL03347:Mtmr9 APN 14 63543567 missense probably benign 0.03
R0089:Mtmr9 UTSW 14 63528247 missense possibly damaging 0.80
R1231:Mtmr9 UTSW 14 63528191 missense possibly damaging 0.55
R1562:Mtmr9 UTSW 14 63534337 missense probably benign
R1726:Mtmr9 UTSW 14 63537098 missense possibly damaging 0.93
R2016:Mtmr9 UTSW 14 63540264 missense possibly damaging 0.59
R3751:Mtmr9 UTSW 14 63543548 missense probably damaging 1.00
R6092:Mtmr9 UTSW 14 63542452 missense possibly damaging 0.47
R6139:Mtmr9 UTSW 14 63529778 missense probably benign
R6928:Mtmr9 UTSW 14 63543593 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGGTTACCAGCTGACCATCTTC -3'
(R):5'- GGGAGCTTCACAGAAGTTGC -3'

Sequencing Primer
(F):5'- TCAAAAACCAACTACTGTGGCATGTG -3'
(R):5'- GAGCTTCACAGAAGTTGCTTTTGAC -3'
Posted On2019-06-26