Incidental Mutation 'R7158:Pacsin2'
ID557467
Institutional Source Beutler Lab
Gene Symbol Pacsin2
Ensembl Gene ENSMUSG00000016664
Gene Nameprotein kinase C and casein kinase substrate in neurons 2
SynonymsSyndapin II
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83375607-83464606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83379742 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 365 (E365K)
Ref Sequence ENSEMBL: ENSMUSP00000058320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056177] [ENSMUST00000165095] [ENSMUST00000171436] [ENSMUST00000230679] [ENSMUST00000231184] [ENSMUST00000231946]
PDB Structure
Crystal structure of mouse pacsin2 F-BAR domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056177
AA Change: E365K

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058320
Gene: ENSMUSG00000016664
AA Change: E365K

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165095
AA Change: E365K

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130098
Gene: ENSMUSG00000016664
AA Change: E365K

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171436
AA Change: E365K

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131504
Gene: ENSMUSG00000016664
AA Change: E365K

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230030
Predicted Effect possibly damaging
Transcript: ENSMUST00000230679
AA Change: E365K

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231184
AA Change: E365K

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000231946
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation by regulating tubulin polymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Pacsin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Pacsin2 APN 15 83386686 missense probably damaging 1.00
IGL02574:Pacsin2 APN 15 83388663 missense possibly damaging 0.81
R0153:Pacsin2 UTSW 15 83377661 missense probably benign 0.11
R0399:Pacsin2 UTSW 15 83386782 missense probably damaging 1.00
R0426:Pacsin2 UTSW 15 83379795 missense possibly damaging 0.90
R0799:Pacsin2 UTSW 15 83379797 missense probably benign 0.44
R0842:Pacsin2 UTSW 15 83379181 missense probably damaging 0.99
R1591:Pacsin2 UTSW 15 83385051 missense probably damaging 1.00
R2406:Pacsin2 UTSW 15 83385112 unclassified probably benign
R3906:Pacsin2 UTSW 15 83379055 missense probably damaging 1.00
R4686:Pacsin2 UTSW 15 83381775 missense probably benign 0.01
R4815:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R5849:Pacsin2 UTSW 15 83390518 missense possibly damaging 0.87
R6010:Pacsin2 UTSW 15 83381819 missense possibly damaging 0.87
R6152:Pacsin2 UTSW 15 83377699 missense probably damaging 1.00
R6367:Pacsin2 UTSW 15 83381832 missense probably benign
R6457:Pacsin2 UTSW 15 83379678 splice site probably null
R7220:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
X0027:Pacsin2 UTSW 15 83392602 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCCATGCATTGCTGAAGTGC -3'
(R):5'- TGACTTGTCGACATATAGCCACATG -3'

Sequencing Primer
(F):5'- CATGCATTGCTGAAGTGCTGAGG -3'
(R):5'- TGTCGACATATAGCCACATGTCTGAC -3'
Posted On2019-06-26