Incidental Mutation 'R7159:Ptpru'
ID557488
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7159 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131819540 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 280 (L280P)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect probably damaging
Transcript: ENSMUST00000030741
AA Change: L280P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: L280P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097860
AA Change: L208P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: L208P

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000105987
AA Change: L280P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: L280P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,730,579 V500E possibly damaging Het
Ankrd34b T C 13: 92,439,462 S401P probably benign Het
Arfgef2 T A 2: 166,826,928 D41E probably benign Het
Arid1a T C 4: 133,753,568 N15S unknown Het
Arsa A T 15: 89,474,718 probably null Het
B3gnt9 C A 8: 105,254,432 C108F probably damaging Het
Bbc3 C A 7: 16,313,808 Y152* probably null Het
Btbd1 T C 7: 81,818,209 M188V probably benign Het
Caln1 C T 5: 130,822,997 T209I probably benign Het
Casp12 C T 9: 5,353,763 P266S possibly damaging Het
Ccm2l A T 2: 153,070,867 I109F probably damaging Het
Chst15 A C 7: 132,270,258 L98R probably damaging Het
Ctsq A G 13: 61,038,923 M89T probably benign Het
Ddx39b T C 17: 35,247,010 V169A probably benign Het
Ddx58 A G 4: 40,213,804 V618A probably benign Het
Fam57b T C 7: 126,827,495 F80S probably damaging Het
Fhad1 T C 4: 141,951,616 H583R probably benign Het
Fndc1 T A 17: 7,800,931 I139F probably damaging Het
Gm5724 T A 6: 141,773,778 M1L probably damaging Het
Gm7145 C G 1: 117,985,831 H148D probably benign Het
Gpr62 C A 9: 106,465,442 A96S probably damaging Het
Gsap T A 5: 21,270,620 probably null Het
Hdhd5 T A 6: 120,523,471 T89S probably damaging Het
Kcna5 T A 6: 126,533,629 Y512F probably damaging Het
Krt84 C A 15: 101,529,609 E304* probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrp6 C A 6: 134,507,551 V370L probably benign Het
Lrrc3c G A 11: 98,599,318 G167D probably damaging Het
Man2b1 C T 8: 85,087,280 T291M probably benign Het
Mapkbp1 A G 2: 120,025,132 E1438G possibly damaging Het
Med12l A G 3: 59,276,017 T1947A probably benign Het
Myh15 A T 16: 49,061,574 T60S probably damaging Het
Myo5a A T 9: 75,171,563 I868F probably benign Het
Myom3 A T 4: 135,808,851 I1278F probably damaging Het
Nbn G T 4: 15,983,677 probably null Het
Ncam2 G T 16: 81,490,374 S392I probably damaging Het
Nrg3 A C 14: 38,370,735 L647* probably null Het
Olfr1062 T A 2: 86,423,612 probably null Het
Olfr1393 A T 11: 49,280,358 D70V probably damaging Het
Olfr1406 A T 1: 173,184,323 L37Q possibly damaging Het
Olfr721-ps1 T C 14: 14,407,251 S8P possibly damaging Het
Pcdhb9 A G 18: 37,401,492 N180D possibly damaging Het
Pcdhga4 A G 18: 37,686,919 N507S probably damaging Het
Pdilt A G 7: 119,487,951 V492A probably benign Het
Phf12 A G 11: 78,023,540 T603A possibly damaging Het
Phox2b T A 5: 67,097,585 I174F probably benign Het
Polq A T 16: 37,062,853 Q1793L possibly damaging Het
Prmt9 T C 8: 77,555,764 F97L probably benign Het
Prpsap1 T C 11: 116,494,044 E13G probably benign Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rc3h2 T C 2: 37,409,647 S124G probably benign Het
Rdh5 A G 10: 128,918,315 I83T possibly damaging Het
Ryr2 T G 13: 11,810,908 R561S probably damaging Het
Scara3 A G 14: 65,920,780 L593P probably damaging Het
Scfd2 T C 5: 74,531,343 I93V probably benign Het
Sema4f C A 6: 82,917,883 V444L possibly damaging Het
Spata33 T C 8: 123,214,395 L61P unknown Het
Stard10 A T 7: 101,343,136 probably null Het
Stub1 T C 17: 25,832,064 I115V probably benign Het
Tmem247 C T 17: 86,918,282 T50I probably benign Het
Tnrc6b A G 15: 80,887,022 M1103V possibly damaging Het
Trim61 T C 8: 65,013,874 Y245C probably benign Het
Trip13 T C 13: 73,920,011 I284V probably benign Het
Trpm4 T C 7: 45,327,268 probably null Het
Ttn A G 2: 76,730,574 L29161S probably damaging Het
Ttn C A 2: 76,909,748 L3528F unknown Het
Ube2v2 G A 16: 15,581,084 T47I probably benign Het
Vwa5b1 C T 4: 138,575,422 A921T possibly damaging Het
Xylt1 T A 7: 117,637,602 F526Y probably damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACACTGTTCAGGTCACAGC -3'
(R):5'- TCTTCAGCGTCAGAGTGGAG -3'

Sequencing Primer
(F):5'- CTGTTCAGGTCACAGCTAGAAAATAC -3'
(R):5'- AGCGTCAGAGTGGAGTGCTG -3'
Posted On2019-06-26