Incidental Mutation 'R7159:Stub1'
ID557538
Institutional Source Beutler Lab
Gene Symbol Stub1
Ensembl Gene ENSMUSG00000039615
Gene NameSTIP1 homology and U-Box containing protein 1
Synonyms0610033N24Rik, 2210017D18Rik, 2310040B03Rik, CHIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R7159 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25830636-25833361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25832064 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 115 (I115V)
Ref Sequence ENSEMBL: ENSMUSP00000040431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000123582] [ENSMUST00000133595] [ENSMUST00000183929] [ENSMUST00000184865]
PDB Structure
CRYSTAL STRUCTURE OF THE CHIP U-BOX E3 UBIQUITIN LIGASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CHIP-UBC13-UEV1A COMPLEX [X-RAY DIFFRACTION]
Crystal structure of TPR domain of CHIP complexed with pseudophosphorylated Smad1 peptide [X-RAY DIFFRACTION]
Crystal structure of the TPR domain of CHIP complexed with Hsp70-C peptide [X-RAY DIFFRACTION]
Crystal structure of the TPR domain of CHIP complexed with phosphorylated Smad1 peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026831
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026833
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000044911
AA Change: I115V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615
AA Change: I115V

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect probably benign
Transcript: ENSMUST00000183929
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184865
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeat and a U-box that functions as a ubiquitin ligase/cochaperone. The encoded protein binds to and ubiquitinates shock cognate 71 kDa protein (Hspa8) and DNA polymerase beta (Polb), among other targets. Mutations in this gene cause spinocerebellar ataxia, autosomal recessive 16. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 2. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygous null mice develop normally but are susceptible to stress-induced apoptosis of multiple organs. Increased peri- and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T A 7: 75,730,579 V500E possibly damaging Het
Ankrd34b T C 13: 92,439,462 S401P probably benign Het
Arfgef2 T A 2: 166,826,928 D41E probably benign Het
Arid1a T C 4: 133,753,568 N15S unknown Het
Arsa A T 15: 89,474,718 probably null Het
B3gnt9 C A 8: 105,254,432 C108F probably damaging Het
Bbc3 C A 7: 16,313,808 Y152* probably null Het
Btbd1 T C 7: 81,818,209 M188V probably benign Het
Caln1 C T 5: 130,822,997 T209I probably benign Het
Casp12 C T 9: 5,353,763 P266S possibly damaging Het
Ccm2l A T 2: 153,070,867 I109F probably damaging Het
Chst15 A C 7: 132,270,258 L98R probably damaging Het
Ctsq A G 13: 61,038,923 M89T probably benign Het
Ddx39b T C 17: 35,247,010 V169A probably benign Het
Ddx58 A G 4: 40,213,804 V618A probably benign Het
Fam57b T C 7: 126,827,495 F80S probably damaging Het
Fhad1 T C 4: 141,951,616 H583R probably benign Het
Fndc1 T A 17: 7,800,931 I139F probably damaging Het
Gm5724 T A 6: 141,773,778 M1L probably damaging Het
Gm7145 C G 1: 117,985,831 H148D probably benign Het
Gpr62 C A 9: 106,465,442 A96S probably damaging Het
Gsap T A 5: 21,270,620 probably null Het
Hdhd5 T A 6: 120,523,471 T89S probably damaging Het
Kcna5 T A 6: 126,533,629 Y512F probably damaging Het
Krt84 C A 15: 101,529,609 E304* probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lrp6 C A 6: 134,507,551 V370L probably benign Het
Lrrc3c G A 11: 98,599,318 G167D probably damaging Het
Man2b1 C T 8: 85,087,280 T291M probably benign Het
Mapkbp1 A G 2: 120,025,132 E1438G possibly damaging Het
Med12l A G 3: 59,276,017 T1947A probably benign Het
Myh15 A T 16: 49,061,574 T60S probably damaging Het
Myo5a A T 9: 75,171,563 I868F probably benign Het
Myom3 A T 4: 135,808,851 I1278F probably damaging Het
Nbn G T 4: 15,983,677 probably null Het
Ncam2 G T 16: 81,490,374 S392I probably damaging Het
Nrg3 A C 14: 38,370,735 L647* probably null Het
Olfr1062 T A 2: 86,423,612 probably null Het
Olfr1393 A T 11: 49,280,358 D70V probably damaging Het
Olfr1406 A T 1: 173,184,323 L37Q possibly damaging Het
Olfr721-ps1 T C 14: 14,407,251 S8P possibly damaging Het
Pcdhb9 A G 18: 37,401,492 N180D possibly damaging Het
Pcdhga4 A G 18: 37,686,919 N507S probably damaging Het
Pdilt A G 7: 119,487,951 V492A probably benign Het
Phf12 A G 11: 78,023,540 T603A possibly damaging Het
Phox2b T A 5: 67,097,585 I174F probably benign Het
Polq A T 16: 37,062,853 Q1793L possibly damaging Het
Prmt9 T C 8: 77,555,764 F97L probably benign Het
Prpsap1 T C 11: 116,494,044 E13G probably benign Het
Ptpru A G 4: 131,819,540 L280P probably damaging Het
Pygl A T 12: 70,197,406 M587K probably benign Het
Rc3h2 T C 2: 37,409,647 S124G probably benign Het
Rdh5 A G 10: 128,918,315 I83T possibly damaging Het
Ryr2 T G 13: 11,810,908 R561S probably damaging Het
Scara3 A G 14: 65,920,780 L593P probably damaging Het
Scfd2 T C 5: 74,531,343 I93V probably benign Het
Sema4f C A 6: 82,917,883 V444L possibly damaging Het
Spata33 T C 8: 123,214,395 L61P unknown Het
Stard10 A T 7: 101,343,136 probably null Het
Tmem247 C T 17: 86,918,282 T50I probably benign Het
Tnrc6b A G 15: 80,887,022 M1103V possibly damaging Het
Trim61 T C 8: 65,013,874 Y245C probably benign Het
Trip13 T C 13: 73,920,011 I284V probably benign Het
Trpm4 T C 7: 45,327,268 probably null Het
Ttn A G 2: 76,730,574 L29161S probably damaging Het
Ttn C A 2: 76,909,748 L3528F unknown Het
Ube2v2 G A 16: 15,581,084 T47I probably benign Het
Vwa5b1 C T 4: 138,575,422 A921T possibly damaging Het
Xylt1 T A 7: 117,637,602 F526Y probably damaging Het
Other mutations in Stub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0619:Stub1 UTSW 17 25831322 unclassified probably null
R1553:Stub1 UTSW 17 25832123 missense probably damaging 1.00
R2095:Stub1 UTSW 17 25830890 missense probably damaging 1.00
R3889:Stub1 UTSW 17 25831302 unclassified probably benign
R4626:Stub1 UTSW 17 25831871 unclassified probably null
R5070:Stub1 UTSW 17 25832138 missense probably damaging 1.00
R6223:Stub1 UTSW 17 25832813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTTCTTAGCAATGCGAAGG -3'
(R):5'- CTGAGCCCACACTCTTTGAC -3'

Sequencing Primer
(F):5'- GGGCACTAGGAATATCATCCC -3'
(R):5'- AGACTCGGAACCCACTTGTG -3'
Posted On2019-06-26