Incidental Mutation 'R7161:Coq8a'
ID557548
Institutional Source Beutler Lab
Gene Symbol Coq8a
Ensembl Gene ENSMUSG00000026489
Gene Namecoenzyme Q8A
Synonyms4632432J16Rik, Cabc1, Adck3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.717) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location180165238-180199602 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 180170341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027766] [ENSMUST00000027766] [ENSMUST00000111117] [ENSMUST00000160169] [ENSMUST00000160879] [ENSMUST00000161300] [ENSMUST00000161300] [ENSMUST00000161632] [ENSMUST00000162769] [ENSMUST00000162769] [ENSMUST00000170472] [ENSMUST00000170472]
Predicted Effect probably null
Transcript: ENSMUST00000027766
SMART Domains Protein: ENSMUSP00000027766
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.4e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000027766
SMART Domains Protein: ENSMUSP00000027766
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111117
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143176
SMART Domains Protein: ENSMUSP00000115261
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
Pfam:DMPK_coil 84 144 1.3e-29 PFAM
C1 203 252 4.09e-7 SMART
PH 273 393 6.02e-8 SMART
CNH 418 695 3.37e-17 SMART
low complexity region 740 752 N/A INTRINSIC
PBD 761 796 1.02e-5 SMART
PBD 802 839 2.21e-1 SMART
low complexity region 877 892 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 952 966 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160169
SMART Domains Protein: ENSMUSP00000125089
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160879
SMART Domains Protein: ENSMUSP00000141948
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161300
SMART Domains Protein: ENSMUSP00000125002
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:ABC1 93 187 5.8e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161300
SMART Domains Protein: ENSMUSP00000125002
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:ABC1 93 187 5.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161632
SMART Domains Protein: ENSMUSP00000124481
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 44 63 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162769
Predicted Effect probably null
Transcript: ENSMUST00000162769
Predicted Effect probably null
Transcript: ENSMUST00000170472
SMART Domains Protein: ENSMUSP00000128290
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.1e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170472
SMART Domains Protein: ENSMUSP00000128290
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.1e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Coq8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Coq8a APN 1 180168389 missense probably benign 0.11
IGL01797:Coq8a APN 1 180169719 splice site probably null
IGL01873:Coq8a APN 1 180178977 missense probably damaging 1.00
R1148:Coq8a UTSW 1 180169403 splice site probably benign
R1421:Coq8a UTSW 1 180170441 splice site probably benign
R1743:Coq8a UTSW 1 180182229 missense probably benign 0.14
R4678:Coq8a UTSW 1 180170081 missense probably damaging 0.99
R4827:Coq8a UTSW 1 180167338 missense possibly damaging 0.46
R4904:Coq8a UTSW 1 180178603 missense probably damaging 1.00
R5716:Coq8a UTSW 1 180179260 missense possibly damaging 0.94
R5769:Coq8a UTSW 1 180179116 missense probably damaging 1.00
R6636:Coq8a UTSW 1 180178987 missense probably benign 0.00
R6991:Coq8a UTSW 1 180179068 missense probably benign 0.00
R7125:Coq8a UTSW 1 180168801 missense probably damaging 1.00
R7158:Coq8a UTSW 1 180179184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGTACTCCAGCTTGTCCCTC -3'
(R):5'- AGCTTAATGGCCCTGTTCTAC -3'

Sequencing Primer
(F):5'- AGCTTGTCCCTCCAGTGG -3'
(R):5'- TTCTACCCAGGAGGCCACATG -3'
Posted On2019-06-26