Incidental Mutation 'R7161:Disp1'
ID557550
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Namedispatched RND transporter family member 1
Synonyms1190008H24Rik, DispA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location183086266-183221522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 183087625 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1077 (M1077T)
Ref Sequence ENSEMBL: ENSMUSP00000003035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003035
AA Change: M1077T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: M1077T

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171366
AA Change: M1077T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: M1077T

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195372
AA Change: M1077T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: M1077T

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1120:Disp1 UTSW 1 183098575 missense probably benign 0.24
R1482:Disp1 UTSW 1 183086474 missense possibly damaging 0.61
R1655:Disp1 UTSW 1 183087004 missense probably benign 0.01
R1660:Disp1 UTSW 1 183087742 missense probably damaging 1.00
R1816:Disp1 UTSW 1 183098575 missense probably damaging 0.99
R1835:Disp1 UTSW 1 183089000 missense probably damaging 1.00
R1954:Disp1 UTSW 1 183088543 missense probably damaging 0.99
R2025:Disp1 UTSW 1 183088203 missense probably damaging 1.00
R2136:Disp1 UTSW 1 183088378 missense probably damaging 1.00
R2150:Disp1 UTSW 1 183088372 missense probably damaging 1.00
R2207:Disp1 UTSW 1 183088342 missense possibly damaging 0.94
R2392:Disp1 UTSW 1 183087167 missense probably benign
R2831:Disp1 UTSW 1 183089319 small deletion probably benign
R3111:Disp1 UTSW 1 183087523 missense probably damaging 1.00
R3116:Disp1 UTSW 1 183088922 missense probably benign 0.01
R3160:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3161:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3716:Disp1 UTSW 1 183087751 missense probably damaging 1.00
R3914:Disp1 UTSW 1 183089102 missense probably benign 0.05
R4061:Disp1 UTSW 1 183087700 missense probably damaging 0.96
R4191:Disp1 UTSW 1 183089173 missense probably damaging 1.00
R4261:Disp1 UTSW 1 183089386 missense probably damaging 1.00
R4272:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4273:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4351:Disp1 UTSW 1 183099978 missense probably benign 0.01
R4672:Disp1 UTSW 1 183098651 critical splice acceptor site probably null
R4764:Disp1 UTSW 1 183088096 missense probably damaging 1.00
R4910:Disp1 UTSW 1 183135463 missense probably damaging 1.00
R5150:Disp1 UTSW 1 183089499 missense probably damaging 0.98
R5502:Disp1 UTSW 1 183087886 missense probably damaging 1.00
R5616:Disp1 UTSW 1 183088349 missense probably benign 0.30
R5699:Disp1 UTSW 1 183088555 nonsense probably null
R5813:Disp1 UTSW 1 183088410 missense probably damaging 1.00
R5820:Disp1 UTSW 1 183135587 missense probably benign 0.00
R6184:Disp1 UTSW 1 183086332 missense probably benign 0.00
R6228:Disp1 UTSW 1 183099025 missense possibly damaging 0.59
R6306:Disp1 UTSW 1 183087148 missense possibly damaging 0.93
R6505:Disp1 UTSW 1 183086512 missense probably benign 0.02
R6925:Disp1 UTSW 1 183086478 missense probably benign
R7016:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7045:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7046:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7047:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7114:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7123:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7124:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7125:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7510:Disp1 UTSW 1 183088411 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGACTGCACTGGAGTTTTG -3'
(R):5'- ATATTTGTCACAGTCGGGTCCC -3'

Sequencing Primer
(F):5'- TTGTAGGGAAAGGGATCTGGCC -3'
(R):5'- ACAGTCGGGTCCCTGGTC -3'
Posted On2019-06-26