Incidental Mutation 'R7161:Pou2f3'
ID557586
Institutional Source Beutler Lab
Gene Symbol Pou2f3
Ensembl Gene ENSMUSG00000032015
Gene NamePOU domain, class 2, transcription factor 3
SynonymsOtf-11, Epoc-1, Oct11, Skin, Skn-li, Skn-1a, Oct-11a, Skin-1a, Otf11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location43123939-43210369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43139363 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 234 (N234S)
Ref Sequence ENSEMBL: ENSMUSP00000135115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034513] [ENSMUST00000176636]
Predicted Effect probably damaging
Transcript: ENSMUST00000034513
AA Change: N222S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034513
Gene: ENSMUSG00000032015
AA Change: N222S

DomainStartEndE-ValueType
low complexity region 107 122 N/A INTRINSIC
low complexity region 150 162 N/A INTRINSIC
POU 164 238 1.47e-53 SMART
low complexity region 239 256 N/A INTRINSIC
HOX 262 324 8.39e-20 SMART
low complexity region 337 352 N/A INTRINSIC
low complexity region 362 378 N/A INTRINSIC
low complexity region 386 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176636
AA Change: N234S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135115
Gene: ENSMUSG00000032015
AA Change: N234S

DomainStartEndE-ValueType
low complexity region 119 134 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
POU 176 250 1.47e-53 SMART
low complexity region 251 268 N/A INTRINSIC
HOX 274 336 8.39e-20 SMART
low complexity region 349 364 N/A INTRINSIC
low complexity region 374 390 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one null mutation exhibit defective keratinocyte differentiation, however the skin and coat appear normal. Mice homozygous for another null mutation display loss of sweet, umami and bitter taste perception and expansion of sour taste receptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Pou2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pou2f3 APN 9 43128893 missense probably damaging 1.00
IGL00508:Pou2f3 APN 9 43139963 missense probably benign 0.01
IGL00975:Pou2f3 APN 9 43137384 missense probably benign
IGL01577:Pou2f3 APN 9 43146881 nonsense probably null
IGL01871:Pou2f3 APN 9 43134473 splice site probably benign
IGL02370:Pou2f3 APN 9 43137348 missense probably damaging 1.00
IGL02674:Pou2f3 APN 9 43139333 missense probably damaging 1.00
IGL02746:Pou2f3 APN 9 43146846 missense probably benign 0.01
IGL02956:Pou2f3 APN 9 43142805 splice site probably benign
IGL02962:Pou2f3 APN 9 43125089 utr 3 prime probably benign
IGL03082:Pou2f3 APN 9 43146915 critical splice acceptor site probably null
R0433:Pou2f3 UTSW 9 43127398 missense probably benign 0.23
R0622:Pou2f3 UTSW 9 43125119 missense probably damaging 1.00
R0926:Pou2f3 UTSW 9 43146901 missense probably damaging 1.00
R1956:Pou2f3 UTSW 9 43145237 missense probably benign
R4782:Pou2f3 UTSW 9 43139858 missense probably damaging 0.97
R4877:Pou2f3 UTSW 9 43139323 missense possibly damaging 0.58
R5070:Pou2f3 UTSW 9 43145281 missense possibly damaging 0.52
R5910:Pou2f3 UTSW 9 43134474 splice site probably null
R6280:Pou2f3 UTSW 9 43139339 missense probably damaging 1.00
R6280:Pou2f3 UTSW 9 43139340 missense probably damaging 1.00
R6465:Pou2f3 UTSW 9 43139867 missense probably damaging 1.00
R7084:Pou2f3 UTSW 9 43128893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTCTTGGTTCGTGCCAG -3'
(R):5'- AGATACAAGGCTGTGCGCAG -3'

Sequencing Primer
(F):5'- TTCGTGCCAGGCTGAAGAG -3'
(R):5'- AGATGCTCAGGGCTCTGACTG -3'
Posted On2019-06-26