Incidental Mutation 'R7161:Abca8a'
ID557596
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110074142 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 443 (Q443L)
Ref Sequence ENSEMBL: ENSMUSP00000045808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106664]
Predicted Effect probably benign
Transcript: ENSMUST00000046223
AA Change: Q443L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: Q443L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100287
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106664
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114393
Gene: ENSMUSG00000041828
AA Change: Q60L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ABC_tran 114 210 4.5e-18 PFAM
Meta Mutation Damage Score 0.1404 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 intron probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7437:Abca8a UTSW 11 110050964 missense probably benign
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGGCAGGCTCCATATTAG -3'
(R):5'- AATGTATGCCATCACCATCTTCTG -3'

Sequencing Primer
(F):5'- TGCCCAGGCTCAAGGAACTTAG -3'
(R):5'- TATGGTCCCCAGCAGGAAGTG -3'
Posted On2019-06-26