Incidental Mutation 'R7161:Afdn'
ID557608
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Nameafadin, adherens junction formation factor
SynonymsAfadin, I-afadin, AF6, Mllt4, S-afadin, 5033403D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location13760539-13906150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13888946 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1592 (M1592K)
Ref Sequence ENSEMBL: ENSMUSP00000118318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
PDB Structure
Solution structure of the FHA domain of mouse Afadin 6 [SOLUTION NMR]
Solution Structure of Ras-binding Domain in Mouse AF-6 Protein [SOLUTION NMR]
Crystal structure of afadin PDZ domain in complex with the C-terminal peptide from nectin-3 [X-RAY DIFFRACTION]
Predicted Effect
SMART Domains Protein: ENSMUSP00000116711
Gene: ENSMUSG00000068036
AA Change: M139K

DomainStartEndE-ValueType
coiled coil region 70 110 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 252 266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137708
AA Change: M1592K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: M1592K

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137784
AA Change: M1599K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: M1599K

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139666
AA Change: M1592K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: M1592K

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150848
AA Change: M1577K

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: M1577K

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170827
AA Change: M1577K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: M1577K

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pde6a A T 18: 61,281,525 M714L probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 13884628 missense probably damaging 1.00
IGL00784:Afdn APN 17 13849263 splice site probably benign
IGL00971:Afdn APN 17 13852313 splice site probably benign
IGL01403:Afdn APN 17 13903870 missense probably damaging 1.00
IGL01944:Afdn APN 17 13810481 missense probably damaging 1.00
IGL02474:Afdn APN 17 13818229 missense probably damaging 1.00
IGL02615:Afdn APN 17 13825976 missense probably benign 0.00
IGL02664:Afdn APN 17 13852466 splice site probably benign
IGL03036:Afdn APN 17 13888088 missense probably benign 0.12
jubilee UTSW 17 13887986 missense probably damaging 1.00
IGL03134:Afdn UTSW 17 13846286 missense probably benign 0.04
R0112:Afdn UTSW 17 13884637 missense probably damaging 1.00
R0226:Afdn UTSW 17 13899146 missense probably benign 0.00
R0305:Afdn UTSW 17 13888514 unclassified probably null
R0310:Afdn UTSW 17 13885508 critical splice donor site probably null
R0711:Afdn UTSW 17 13852436 missense probably damaging 1.00
R0828:Afdn UTSW 17 13903998 missense probably damaging 1.00
R1268:Afdn UTSW 17 13887986 missense probably damaging 1.00
R1317:Afdn UTSW 17 13846273 missense probably benign 0.11
R1386:Afdn UTSW 17 13846536 missense probably damaging 1.00
R1438:Afdn UTSW 17 13855390 missense probably damaging 1.00
R1607:Afdn UTSW 17 13810501 missense probably damaging 1.00
R1819:Afdn UTSW 17 13850848 missense probably damaging 1.00
R1872:Afdn UTSW 17 13881316 missense probably damaging 1.00
R1880:Afdn UTSW 17 13852353 missense possibly damaging 0.84
R2049:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2140:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2142:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2162:Afdn UTSW 17 13896174 missense probably benign 0.01
R2221:Afdn UTSW 17 13883737 splice site probably benign
R2223:Afdn UTSW 17 13883737 splice site probably benign
R2291:Afdn UTSW 17 13888891 missense probably damaging 1.00
R2993:Afdn UTSW 17 13891000 critical splice donor site probably null
R3402:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3403:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3690:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3691:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3764:Afdn UTSW 17 13846589 missense probably benign 0.07
R3832:Afdn UTSW 17 13896174 missense probably benign 0.01
R4002:Afdn UTSW 17 13883917 missense probably damaging 1.00
R4440:Afdn UTSW 17 13850890 missense probably damaging 1.00
R4621:Afdn UTSW 17 13888820 missense probably damaging 1.00
R4935:Afdn UTSW 17 13890966 missense probably benign 0.30
R5279:Afdn UTSW 17 13888952 missense probably damaging 1.00
R5421:Afdn UTSW 17 13832406 missense probably benign 0.25
R5689:Afdn UTSW 17 13855359 missense probably damaging 1.00
R6332:Afdn UTSW 17 13810445 missense possibly damaging 0.92
R6369:Afdn UTSW 17 13835343 nonsense probably null
R6433:Afdn UTSW 17 13881299 missense probably damaging 1.00
R6467:Afdn UTSW 17 13804053 missense probably damaging 1.00
R6500:Afdn UTSW 17 13822372 missense possibly damaging 0.67
R6564:Afdn UTSW 17 13896089 missense probably benign
R6705:Afdn UTSW 17 13888021 missense probably benign 0.01
R6733:Afdn UTSW 17 13823353 missense probably benign 0.39
R6983:Afdn UTSW 17 13881321 missense probably damaging 1.00
R7089:Afdn UTSW 17 13890812 intron probably null
R7175:Afdn UTSW 17 13888607 missense probably damaging 1.00
X0060:Afdn UTSW 17 13818170 nonsense probably null
X0064:Afdn UTSW 17 13888027 missense possibly damaging 0.60
Z1088:Afdn UTSW 17 13883780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCCTGGAAACGAGATG -3'
(R):5'- CAAGTTGTCAGCCAAGAGTGAG -3'

Sequencing Primer
(F):5'- TGCACATTGTGGACATGCTAAGC -3'
(R):5'- GCAAAAGAAACCAGGGGTCTTTAAAC -3'
Posted On2019-06-26