Incidental Mutation 'R7161:Pde6a'
ID557613
Institutional Source Beutler Lab
Gene Symbol Pde6a
Ensembl Gene ENSMUSG00000024575
Gene Namephosphodiesterase 6A, cGMP-specific, rod, alpha
SynonymsPdea
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7161 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61220482-61289924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61281525 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 714 (M714L)
Ref Sequence ENSEMBL: ENSMUSP00000025468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025468]
Predicted Effect probably benign
Transcript: ENSMUST00000025468
AA Change: M714L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: M714L

DomainStartEndE-ValueType
GAF 73 232 1.36e-21 SMART
GAF 254 441 3.21e-23 SMART
low complexity region 478 495 N/A INTRINSIC
Blast:HDc 496 540 3e-11 BLAST
HDc 556 734 6.95e-8 SMART
Blast:HDc 759 786 1e-8 BLAST
low complexity region 817 837 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115963
Gene: ENSMUSG00000024575
AA Change: M35L

DomainStartEndE-ValueType
Pfam:PDEase_I 8 125 1.1e-30 PFAM
low complexity region 139 159 N/A INTRINSIC
low complexity region 161 175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,806,788 R258L unknown Het
Abca8a T A 11: 110,074,142 Q443L probably benign Het
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Afdn T A 17: 13,888,946 M1592K possibly damaging Het
Bpifb9b A T 2: 154,313,615 T345S possibly damaging Het
Bub1b A G 2: 118,626,053 E526G probably damaging Het
Car13 A G 3: 14,645,208 D70G probably benign Het
Ccdc127 A T 13: 74,352,877 L4F probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ccr10 A G 11: 101,174,278 I142T probably benign Het
Cep126 C T 9: 8,087,399 V1005M probably benign Het
Chil6 A G 3: 106,394,412 I124T probably benign Het
Coq8a A G 1: 180,170,341 probably null Het
Ctf2 T A 7: 127,719,304 K174N probably damaging Het
Dapk1 T C 13: 60,696,395 V76A possibly damaging Het
Disp1 A G 1: 183,087,625 M1077T possibly damaging Het
Dnah9 T A 11: 65,855,372 K3972* probably null Het
Dusp7 T A 9: 106,368,915 S40T unknown Het
Emg1 T C 6: 124,705,749 T88A probably benign Het
Fbxo5 A G 10: 5,802,043 V190A possibly damaging Het
Fbxw20 T G 9: 109,225,980 D167A probably damaging Het
Fes A T 7: 80,380,861 V562E probably damaging Het
Foxj1 C G 11: 116,332,408 G190R probably damaging Het
Gatsl2 C A 5: 134,135,190 T75N probably damaging Het
Gdf15 T G 8: 70,631,342 S91R possibly damaging Het
Gm4846 C A 1: 166,487,010 V355F probably damaging Het
Herc4 T A 10: 63,308,415 Y776N probably benign Het
Hspg2 G A 4: 137,514,719 R588H probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Itpr1 C T 6: 108,386,640 A741V probably damaging Het
Kbtbd8 T A 6: 95,126,696 I519K probably benign Het
Kcnh5 T A 12: 74,897,709 Q922L probably benign Het
Kiss1r T C 10: 79,919,489 Y103H probably damaging Het
Knl1 A G 2: 119,070,785 E989G possibly damaging Het
Lamc1 A T 1: 153,226,454 L1466Q probably damaging Het
Lap3 C T 5: 45,498,467 P138L probably benign Het
Lhx1 G A 11: 84,519,872 P300S probably damaging Het
Mppe1 G A 18: 67,229,771 A131V probably benign Het
Neb A T 2: 52,271,592 Y2063N probably damaging Het
Nfe2l1 A G 11: 96,817,720 F740L probably benign Het
Nop10 A G 2: 112,262,046 N8S probably benign Het
Olfr1097 A C 2: 86,890,649 H175Q probably benign Het
Opalin T A 19: 41,069,935 T20S possibly damaging Het
Pask C T 1: 93,310,905 S1286N probably benign Het
Pcdhgc4 A T 18: 37,815,663 E44V probably damaging Het
Pde1a A G 2: 79,865,214 M463T probably benign Het
Pik3c2b A G 1: 133,106,112 E1618G probably damaging Het
Pou2f3 T C 9: 43,139,363 N234S probably damaging Het
Ptprm T A 17: 66,809,627 T886S probably benign Het
Rab11fip3 C A 17: 26,069,090 D30Y probably benign Het
Rassf10 A T 7: 112,954,500 I103F probably damaging Het
Rfc4 A G 16: 23,115,433 I206T probably benign Het
Rhcg A G 7: 79,617,441 F29S probably damaging Het
Sec11c A G 18: 65,812,732 I89V probably benign Het
Serac1 T C 17: 6,065,076 D204G probably damaging Het
Serpinb3c T C 1: 107,273,162 N175S probably null Het
Slc25a19 C T 11: 115,616,547 E250K possibly damaging Het
Slc9a8 A T 2: 167,465,383 Y329F possibly damaging Het
Smagp T C 15: 100,636,245 probably benign Het
Spats1 T A 17: 45,449,169 Q268H probably benign Het
Spef2 T C 15: 9,717,603 T219A probably benign Het
Spink13 A G 18: 62,614,955 M11T probably benign Het
Susd1 T C 4: 59,329,581 D669G possibly damaging Het
Svep1 A G 4: 58,128,859 Y613H possibly damaging Het
Tcp10b T C 17: 13,081,746 *439Q probably null Het
Tmed2 T A 5: 124,546,920 M133K possibly damaging Het
Trpv5 A T 6: 41,660,536 Y370* probably null Het
Ttn A G 2: 76,812,244 S13316P probably damaging Het
Uap1l1 A T 2: 25,363,280 M381K probably damaging Het
Wdr26 A G 1: 181,203,130 Y200H probably damaging Het
Wdr78 G A 4: 103,096,616 P129S probably benign Het
Zfhx4 A T 3: 5,244,083 M790L possibly damaging Het
Zscan25 T C 5: 145,286,441 L173P probably benign Het
Other mutations in Pde6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Pde6a APN 18 61257268 missense probably damaging 1.00
IGL00896:Pde6a APN 18 61220792 missense possibly damaging 0.94
IGL01595:Pde6a APN 18 61281528 missense probably damaging 0.98
IGL02971:Pde6a APN 18 61264255 missense probably damaging 1.00
R0219:Pde6a UTSW 18 61285935 missense possibly damaging 0.57
R0968:Pde6a UTSW 18 61253738 missense probably damaging 0.99
R1304:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R1498:Pde6a UTSW 18 61232860 missense possibly damaging 0.73
R1542:Pde6a UTSW 18 61257045 missense possibly damaging 0.93
R1734:Pde6a UTSW 18 61285965 missense probably damaging 1.00
R1795:Pde6a UTSW 18 61257212 missense probably damaging 1.00
R2173:Pde6a UTSW 18 61254382 missense probably damaging 1.00
R2280:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R2281:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R3617:Pde6a UTSW 18 61231503 splice site probably benign
R4620:Pde6a UTSW 18 61262492 missense probably damaging 1.00
R4727:Pde6a UTSW 18 61231489 missense probably benign 0.02
R4863:Pde6a UTSW 18 61245592 missense probably damaging 1.00
R4904:Pde6a UTSW 18 61265034 missense probably benign 0.08
R4945:Pde6a UTSW 18 61234718 missense probably damaging 1.00
R4953:Pde6a UTSW 18 61231362 nonsense probably null
R5323:Pde6a UTSW 18 61232911 missense possibly damaging 0.81
R5496:Pde6a UTSW 18 61253665 critical splice acceptor site probably null
R5540:Pde6a UTSW 18 61231366 missense probably damaging 0.99
R6180:Pde6a UTSW 18 61284092 splice site probably null
R6366:Pde6a UTSW 18 61265071 splice site probably null
R6743:Pde6a UTSW 18 61263986 missense possibly damaging 0.48
R7186:Pde6a UTSW 18 61220606 start codon destroyed probably null 0.95
R7197:Pde6a UTSW 18 61258224 missense probably damaging 0.96
R7296:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R7487:Pde6a UTSW 18 61249960 missense probably damaging 1.00
X0064:Pde6a UTSW 18 61264948 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTAGAGAGCTGAGCCCAATGG -3'
(R):5'- AAAGAGGAAACCCTGGTATTCCC -3'

Sequencing Primer
(F):5'- CCTCTGATTATATACAGAGGCTGGAC -3'
(R):5'- CACTCTTCACTGGAGAACCGGAG -3'
Posted On2019-06-26