Incidental Mutation 'R0586:L3mbtl3'
ID55768
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
MMRRC Submission 038776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0586 (G1)
Quality Score145
Status Validated
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26327834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 366 (V366A)
Ref Sequence ENSEMBL: ENSMUSP00000133479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: V366A
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: V366A

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: V341A
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: V341A

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: V366A
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: V366A

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.4%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,137,091 V145D probably damaging Het
Abca1 A T 4: 53,092,860 V308E probably benign Het
Amy1 A G 3: 113,562,769 probably benign Het
Astn2 C T 4: 66,185,142 V345M unknown Het
Brwd1 T C 16: 96,043,086 E756G probably damaging Het
Ccpg1 C T 9: 73,001,821 L135F probably benign Het
Cecr2 C T 6: 120,757,884 H694Y probably damaging Het
Cfh G A 1: 140,183,182 T14I probably damaging Het
Cfhr2 G A 1: 139,813,434 R268* probably null Het
Clca1 T A 3: 145,032,589 I53L probably benign Het
Clcn6 A G 4: 148,038,749 probably benign Het
Cnfn C T 7: 25,367,831 V98I probably benign Het
Cntnap1 C T 11: 101,187,014 R1122W probably damaging Het
Cpne9 A T 6: 113,295,063 E384V probably damaging Het
Ctr9 T C 7: 111,049,498 probably benign Het
Ctsj T A 13: 61,003,701 probably benign Het
Cyp2c39 A C 19: 39,513,490 probably benign Het
Dock5 A C 14: 67,809,032 I767S probably damaging Het
Eftud2 T C 11: 102,846,620 T552A probably damaging Het
Epdr1 A G 13: 19,594,545 I25T probably damaging Het
Fam160a2 T C 7: 105,389,447 E195G probably damaging Het
Fam208b A G 13: 3,590,321 L272P probably damaging Het
Fcgbp A T 7: 28,089,713 D568V probably damaging Het
Frem2 T A 3: 53,647,921 T1732S probably damaging Het
Fuz T C 7: 44,898,558 V183A possibly damaging Het
Grb7 T C 11: 98,453,220 S284P probably damaging Het
Hoxb4 G T 11: 96,318,887 G40C probably damaging Het
Kcnn1 T C 8: 70,863,869 probably benign Het
Kmt2d C A 15: 98,835,207 probably benign Het
Ldlr G A 9: 21,739,744 R486H probably benign Het
Lnpep A T 17: 17,575,396 probably benign Het
Mical3 A T 6: 121,029,641 probably benign Het
Myh15 T C 16: 49,171,887 probably benign Het
Nup155 T A 15: 8,130,232 H542Q probably benign Het
Olfr1100 T C 2: 86,978,782 N5D probably damaging Het
Olfr1240 T A 2: 89,439,354 R308S possibly damaging Het
Olfr53 T C 7: 140,652,063 F28S probably benign Het
Olfr780 A G 10: 129,322,047 I141M probably benign Het
Olfr967 A T 9: 39,751,118 H244L probably damaging Het
Opn4 A G 14: 34,598,973 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp14 T C 16: 35,841,012 K1522R probably benign Het
Pkhd1 A T 1: 20,524,111 D1259E probably benign Het
Pogz C T 3: 94,879,353 A1084V probably damaging Het
Popdc3 G A 10: 45,315,263 V157M probably benign Het
Prrt4 T C 6: 29,171,184 Y423C probably damaging Het
Qrich1 C T 9: 108,534,520 H415Y probably damaging Het
Rabgap1 A G 2: 37,543,223 N801D probably benign Het
Rb1 A G 14: 73,287,684 probably benign Het
Rp1 A T 1: 4,347,837 N1017K possibly damaging Het
Ryr2 T C 13: 11,635,559 D356G probably null Het
Skint8 C G 4: 111,936,929 P172R probably damaging Het
Slc12a8 T G 16: 33,658,230 M643R possibly damaging Het
Sult1c1 A T 17: 53,964,085 probably benign Het
Tcaf1 T A 6: 42,673,539 M869L probably damaging Het
Tecpr1 T C 5: 144,217,401 N78S probably damaging Het
Tectb A T 19: 55,181,924 Y69F probably damaging Het
Them4 A T 3: 94,329,794 N187I possibly damaging Het
Tm9sf3 A G 19: 41,256,143 probably null Het
Tnik G T 3: 28,577,361 probably benign Het
Tns2 G T 15: 102,109,585 probably benign Het
Tnxb A G 17: 34,672,144 D487G probably damaging Het
Trim33 T A 3: 103,310,344 C202S probably damaging Het
Trpm2 T A 10: 77,923,516 I1145F probably damaging Het
Trpv2 A G 11: 62,592,770 T478A probably benign Het
Ube2e3 T C 2: 78,919,990 Y187H probably benign Het
Ubxn11 A G 4: 134,109,652 R64G possibly damaging Het
Wwtr1 T C 3: 57,459,066 T407A probably damaging Het
Zfyve26 A T 12: 79,268,728 S1325T possibly damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
R7490:L3mbtl3 UTSW 10 26339231 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACCAATAGTCATAGCTCTCATCCCAG -3'
(R):5'- CCTGCCTAGTATCCGTCTCCTAACTAAG -3'

Sequencing Primer
(F):5'- TCCCAGTTGTCAAAATGTACCAGG -3'
(R):5'- CCGTCTCCTAACTAAGGTATTAAAGC -3'
Posted On2013-07-11