Incidental Mutation 'R7163:Plxna4'
ID557726
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R7163 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32496756 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 442 (H442R)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably benign
Transcript: ENSMUST00000115096
AA Change: H442R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: H442R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,408,072 K4R possibly damaging Het
A830018L16Rik G A 1: 11,414,624 G19D probably damaging Het
Abca3 A T 17: 24,364,942 M102L probably benign Het
Adam19 A T 11: 46,131,717 Y499F probably benign Het
Adck2 T C 6: 39,583,863 V444A probably damaging Het
Adck5 T C 15: 76,593,816 V214A probably damaging Het
Agrn G A 4: 156,178,509 T437M probably damaging Het
Aox3 A T 1: 58,119,512 I81F probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Blmh A G 11: 76,946,161 Y23C unknown Het
Cacnb1 A G 11: 98,012,900 V109A probably benign Het
Ccdc27 C T 4: 154,032,825 R555H not run Het
Cep170 A C 1: 176,774,465 S358R probably damaging Het
Cfap46 A T 7: 139,618,078 probably null Het
Dclk1 G T 3: 55,256,128 E214* probably null Het
Dhrs1 A G 14: 55,739,381 L282P probably benign Het
Dlgap5 A G 14: 47,399,638 L461P probably damaging Het
Elp2 G T 18: 24,614,446 C185F probably benign Het
Fbxw7 T C 3: 84,925,585 probably benign Het
Fga T C 3: 83,026,264 V17A probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm43302 T A 5: 105,293,627 probably null Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hcn1 A T 13: 117,925,547 I450L unknown Het
Hydin T A 8: 110,603,336 C4901S probably benign Het
Ino80 A T 2: 119,392,875 I1186N probably damaging Het
Ints7 T A 1: 191,617,837 I781N possibly damaging Het
Irf2 T A 8: 46,837,677 V178E possibly damaging Het
Iws1 T A 18: 32,093,224 S722T possibly damaging Het
Jak1 G A 4: 101,175,188 S407F probably damaging Het
Kdm3a G T 6: 71,632,077 D55E probably damaging Het
Kdm5d T C Y: 899,940 S169P probably damaging Het
Kif15 A G 9: 123,017,657 N1348S probably damaging Het
Kpna7 G A 5: 145,002,396 P187L unknown Het
Krt35 A T 11: 100,096,158 F10Y probably damaging Het
Lemd1 G T 1: 132,256,737 V131F probably benign Het
Mcf2l G A 8: 12,915,439 R4H probably benign Het
Megf6 C T 4: 154,267,441 R1166C probably damaging Het
Mmp11 T C 10: 75,926,576 I308V possibly damaging Het
Mrgpra4 A G 7: 47,981,490 V121A probably benign Het
Myl2 T A 5: 122,101,822 I26N probably damaging Het
Myo15 A G 11: 60,498,369 M862V Het
Nckap5l T C 15: 99,433,473 H64R probably damaging Het
Nipsnap2 A C 5: 129,744,710 E90A probably benign Het
Nup210 G T 6: 91,073,331 N385K probably damaging Het
Olfr1029 T A 2: 85,975,588 L115Q probably damaging Het
Olfr311 T C 11: 58,841,186 V24A probably benign Het
Olfr330 C A 11: 58,529,168 E273* probably null Het
Olfr897-ps1 T C 9: 38,309,049 F85L probably damaging Het
Olfr90 T C 17: 37,086,045 N40S probably damaging Het
Park2 G A 17: 12,061,547 C430Y probably damaging Het
Pcmt1 A T 10: 7,638,158 M249K probably benign Het
Pde3a T C 6: 141,487,544 L767P probably damaging Het
Pde8a T C 7: 81,306,708 V285A possibly damaging Het
Pla2g4a T A 1: 149,840,665 K690* probably null Het
Polr1b A G 2: 129,126,011 D1108G probably benign Het
Sec23ip T C 7: 128,762,533 probably null Het
Slc24a3 A G 2: 145,244,991 D57G probably benign Het
Sprtn T G 8: 124,898,305 F50V probably damaging Het
Srr A G 11: 74,913,002 F43S probably damaging Het
Szt2 A G 4: 118,405,530 F17L possibly damaging Het
Taar1 G T 10: 23,921,020 M205I probably benign Het
Tas2r143 A G 6: 42,400,268 I11V probably benign Het
Tlx1 T C 19: 45,151,216 S101P probably damaging Het
Tmeff2 T C 1: 50,938,344 probably null Het
Vhl A G 6: 113,629,490 D156G possibly damaging Het
Washc4 T A 10: 83,591,033 D1068E probably damaging Het
Zfp513 A G 5: 31,200,732 V101A probably benign Het
Zfp82 T C 7: 30,062,244 R71G probably benign Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAACTGTCATCACCTCC -3'
(R):5'- TTGCTAAGGAGTCTTCTGGCTC -3'

Sequencing Primer
(F):5'- TCCACAACAGCGTATCTCCTCAG -3'
(R):5'- TCTGGCTTCACACTGGTGCAG -3'
Posted On2019-06-26