Incidental Mutation 'R7164:Inpp5e'
ID557779
Institutional Source Beutler Lab
Gene Symbol Inpp5e
Ensembl Gene ENSMUSG00000026925
Gene Nameinositol polyphosphate-5-phosphatase E
Synonyms72kDa, 1200002L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7164 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26396249-26409203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26407983 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 202 (D202V)
Ref Sequence ENSEMBL: ENSMUSP00000119485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082] [ENSMUST00000114090] [ENSMUST00000145701]
Predicted Effect probably benign
Transcript: ENSMUST00000091252
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114082
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114090
AA Change: D202V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109724
Gene: ENSMUSG00000026925
AA Change: D202V

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000145701
AA Change: D202V

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119485
Gene: ENSMUSG00000026925
AA Change: D202V

DomainStartEndE-ValueType
low complexity region 277 294 N/A INTRINSIC
IPPc 300 602 1.27e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156442
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display signs of ciliopathies including prenatal and perinatal lethality, polycystic kidneys, arrest of eye development, abnormalities in primary cilia, cerebral developmental defects, and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Flnb A G 14: 7,915,944 probably null Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Map4k5 T C 12: 69,830,436 T312A probably benign Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Inpp5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Inpp5e APN 2 26408521 missense probably benign
IGL00943:Inpp5e APN 2 26400151 splice site probably benign
IGL01518:Inpp5e APN 2 26397934 missense probably damaging 1.00
R0212:Inpp5e UTSW 2 26408340 unclassified probably null
R1818:Inpp5e UTSW 2 26397874 missense probably benign 0.00
R1876:Inpp5e UTSW 2 26408157 missense possibly damaging 0.91
R2508:Inpp5e UTSW 2 26399343 missense probably damaging 1.00
R4175:Inpp5e UTSW 2 26400925 missense probably damaging 0.99
R4647:Inpp5e UTSW 2 26407914 missense probably benign 0.01
R4668:Inpp5e UTSW 2 26400994 missense probably damaging 0.97
R4895:Inpp5e UTSW 2 26397912 missense probably damaging 1.00
R4908:Inpp5e UTSW 2 26400906 missense probably damaging 1.00
R5090:Inpp5e UTSW 2 26399371 unclassified probably null
R5096:Inpp5e UTSW 2 26399525 missense probably damaging 1.00
R5830:Inpp5e UTSW 2 26400415 missense probably damaging 1.00
R6056:Inpp5e UTSW 2 26407848 nonsense probably null
R6899:Inpp5e UTSW 2 26400048 missense possibly damaging 0.77
R6939:Inpp5e UTSW 2 26407762 splice site probably null
R7003:Inpp5e UTSW 2 26397865 missense probably benign 0.01
R7275:Inpp5e UTSW 2 26408092 missense probably benign 0.00
R7285:Inpp5e UTSW 2 26397858 missense probably benign 0.36
R7468:Inpp5e UTSW 2 26408149 missense probably benign 0.00
X0061:Inpp5e UTSW 2 26402147 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAAAGATCTGGCTGAGTGAATG -3'
(R):5'- TGCAAGACTCAGTAGCCCAG -3'

Sequencing Primer
(F):5'- CTGAGTGAATGGAGTGATCGTC -3'
(R):5'- TCAGCACATCCTTGCAGG -3'
Posted On2019-06-26