Incidental Mutation 'R7164:Map4k5'
ID557817
Institutional Source Beutler Lab
Gene Symbol Map4k5
Ensembl Gene ENSMUSG00000034761
Gene Namemitogen-activated protein kinase kinase kinase kinase 5
SynonymsMAPKKKK5, GCKR, KHS, 4432415E19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7164 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location69803750-69893200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69830436 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 312 (T312A)
Ref Sequence ENSEMBL: ENSMUSP00000126006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049239] [ENSMUST00000110567] [ENSMUST00000110570] [ENSMUST00000171211]
Predicted Effect probably benign
Transcript: ENSMUST00000049239
AA Change: T379A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047812
Gene: ENSMUSG00000034761
AA Change: T379A

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 4.57e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110567
AA Change: T360A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106196
Gene: ENSMUSG00000034761
AA Change: T360A

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 370 377 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
CNH 493 808 3.98e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110570
AA Change: T379A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106199
Gene: ENSMUSG00000034761
AA Change: T379A

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 3.98e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153712
Predicted Effect probably benign
Transcript: ENSMUST00000171211
AA Change: T312A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126006
Gene: ENSMUSG00000034761
AA Change: T312A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 208 2e-32 PFAM
Pfam:Pkinase 1 210 6.2e-52 PFAM
low complexity region 322 329 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
CNH 445 760 4.57e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188608
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and phenotypically normal but show impaired canonical and noncanonical Wnt signaling in progenitor B lymphocytes. Mice homozygous for a gene trap exhibit hypoalgesia, increased serum IgG1 and an increased percentage of peripheral blood CD4+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C A 4: 107,894,890 D155E not run Het
4932415D10Rik G A 10: 82,286,229 T3649I probably damaging Het
Actn2 G A 13: 12,278,961 H558Y probably damaging Het
Akap9 G C 5: 4,060,364 E3022D probably damaging Het
Anapc2 C T 2: 25,284,999 R710C probably damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Carmil3 A G 14: 55,501,282 E844G probably damaging Het
Cdk17 T G 10: 93,232,481 S367A probably benign Het
Cfap206 T A 4: 34,719,656 M253L probably benign Het
Chd3 T G 11: 69,362,306 K228Q probably damaging Het
Cit T A 5: 115,985,787 I1503N possibly damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Degs1 A G 1: 182,279,125 S226P probably damaging Het
Espl1 T C 15: 102,313,203 W976R probably damaging Het
Fbxl4 C T 4: 22,386,218 P275L probably benign Het
Gm996 T A 2: 25,578,567 H444L possibly damaging Het
Gnptab T A 10: 88,434,070 Y878* probably null Het
Gpr89 A T 3: 96,871,398 M453K probably benign Het
Igsf5 A T 16: 96,372,848 Q26L possibly damaging Het
Inpp5e T A 2: 26,407,983 D202V possibly damaging Het
Itga3 C T 11: 95,052,479 V931M possibly damaging Het
Kcnab3 T C 11: 69,331,358 probably null Het
Klk4 T C 7: 43,881,698 I17T possibly damaging Het
Lrrc73 T C 17: 46,256,243 L206P probably damaging Het
Manba A T 3: 135,542,388 N346I probably damaging Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Masp2 A G 4: 148,610,115 probably null Het
Mast1 T C 8: 84,935,304 D63G possibly damaging Het
Mtf2 T A 5: 108,093,369 S254T possibly damaging Het
Myo16 A T 8: 10,569,585 T1379S unknown Het
Myo5a A G 9: 75,180,153 E1097G probably benign Het
Nat1 T C 8: 67,491,677 V238A possibly damaging Het
Nhlrc2 A G 19: 56,592,499 D493G probably damaging Het
Olfr1165-ps T C 2: 88,101,832 K52E probably damaging Het
Olfr1331 C T 4: 118,869,725 P315S probably benign Het
Olfr1462 A T 19: 13,190,906 M80L probably benign Het
Olfr291 A G 7: 84,857,043 I227V possibly damaging Het
Olfr50 T C 2: 36,793,697 S154P probably benign Het
Olfr919 A G 9: 38,698,219 I49T possibly damaging Het
Pcsk5 C T 19: 17,451,985 C1543Y probably damaging Het
Pde4d A G 13: 109,032,688 D88G probably benign Het
Pld5 A T 1: 176,213,621 M1K probably null Het
Prmt6 A G 3: 110,250,364 M203T probably benign Het
Prr14l A T 5: 32,829,166 V995D probably damaging Het
Psg18 T C 7: 18,350,937 E199G possibly damaging Het
Pth1r A G 9: 110,723,747 I439T possibly damaging Het
Ptprc T A 1: 138,117,862 I87F probably benign Het
Slc44a1 T C 4: 53,528,711 S154P probably benign Het
Slco1c1 T A 6: 141,542,129 Y192* probably null Het
Spag16 A G 1: 70,724,866 H615R possibly damaging Het
Tas2r114 G A 6: 131,689,765 A100V possibly damaging Het
U2af1l4 T C 7: 30,565,119 S103P probably benign Het
Usp10 T C 8: 119,942,108 S383P probably damaging Het
Vmn2r113 A G 17: 22,948,163 R505G probably benign Het
Vmn2r75 A C 7: 86,165,384 D300E probably damaging Het
Zfp318 T A 17: 46,397,306 probably null Het
Zfp318 T C 17: 46,405,939 V999A probably damaging Het
Zfp324 A T 7: 12,968,883 H58L probably damaging Het
Zfp707 A G 15: 75,975,118 E339G possibly damaging Het
Other mutations in Map4k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Map4k5 APN 12 69845732 missense probably damaging 1.00
IGL01013:Map4k5 APN 12 69827526 splice site probably benign
IGL01309:Map4k5 APN 12 69841963 missense probably benign 0.00
IGL02314:Map4k5 APN 12 69818439 missense probably benign 0.05
IGL02612:Map4k5 APN 12 69849584 missense possibly damaging 0.63
IGL02620:Map4k5 APN 12 69892702 missense probably benign 0.05
IGL02749:Map4k5 APN 12 69815806 missense probably benign 0.25
R0662:Map4k5 UTSW 12 69813153 missense probably damaging 1.00
R0731:Map4k5 UTSW 12 69874264 intron probably benign
R0828:Map4k5 UTSW 12 69805326 missense probably damaging 0.98
R1026:Map4k5 UTSW 12 69874288 missense possibly damaging 0.95
R1178:Map4k5 UTSW 12 69816378 missense probably damaging 0.99
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1615:Map4k5 UTSW 12 69844413 missense probably damaging 1.00
R1632:Map4k5 UTSW 12 69828047 missense probably benign
R1652:Map4k5 UTSW 12 69830427 critical splice donor site probably null
R1677:Map4k5 UTSW 12 69805308 missense probably benign 0.01
R1835:Map4k5 UTSW 12 69824662 missense probably damaging 1.00
R1895:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1946:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1968:Map4k5 UTSW 12 69818492 missense probably damaging 0.99
R1971:Map4k5 UTSW 12 69826328 missense possibly damaging 0.81
R1987:Map4k5 UTSW 12 69842912 missense probably damaging 1.00
R2070:Map4k5 UTSW 12 69816337 missense probably damaging 0.99
R2471:Map4k5 UTSW 12 69856846 missense probably benign 0.30
R3417:Map4k5 UTSW 12 69809264 missense probably damaging 1.00
R4133:Map4k5 UTSW 12 69845723 missense probably damaging 1.00
R4331:Map4k5 UTSW 12 69827374 missense probably benign 0.00
R4388:Map4k5 UTSW 12 69845809 missense probably damaging 1.00
R4685:Map4k5 UTSW 12 69811366 missense probably benign
R4760:Map4k5 UTSW 12 69824598 missense possibly damaging 0.49
R4822:Map4k5 UTSW 12 69841984 nonsense probably null
R4863:Map4k5 UTSW 12 69818438 missense probably benign 0.04
R4971:Map4k5 UTSW 12 69852719 missense possibly damaging 0.60
R5038:Map4k5 UTSW 12 69824614 missense probably damaging 1.00
R5055:Map4k5 UTSW 12 69831558 missense probably benign
R5248:Map4k5 UTSW 12 69841981 missense probably benign 0.36
R5428:Map4k5 UTSW 12 69838013 missense possibly damaging 0.94
R5697:Map4k5 UTSW 12 69830436 missense probably benign
R5757:Map4k5 UTSW 12 69824655 missense probably damaging 1.00
R5955:Map4k5 UTSW 12 69844390 missense probably damaging 1.00
R6258:Map4k5 UTSW 12 69831562 missense probably benign 0.06
R6259:Map4k5 UTSW 12 69852740 missense probably damaging 0.97
R6260:Map4k5 UTSW 12 69831562 missense probably benign 0.06
R6796:Map4k5 UTSW 12 69818025 missense probably benign 0.01
R6979:Map4k5 UTSW 12 69822848 missense probably damaging 1.00
R7184:Map4k5 UTSW 12 69874321 missense probably benign 0.00
X0062:Map4k5 UTSW 12 69824607 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAAAGCCATGCCAGGAATG -3'
(R):5'- AAACCGATTAGATGCTGTGGTAAC -3'

Sequencing Primer
(F):5'- GCCAGGGCTATATAACATGTCCTG -3'
(R):5'- GGTAACAAGCGGCCACAACATC -3'
Posted On2019-06-26