Incidental Mutation 'R7166:Htt'
ID557928
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Namehuntingtin
SynonymsHD, Hdh, htt, huntingtin, IT15
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34761740-34912534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34852894 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1564 (Q1564K)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
Predicted Effect probably benign
Transcript: ENSMUST00000080036
AA Change: Q1564K

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: Q1564K

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34799408 missense probably benign 0.00
IGL00233:Htt APN 5 34896026 splice site probably null
IGL00559:Htt APN 5 34849104 splice site probably benign
IGL00765:Htt APN 5 34877425 splice site probably benign
IGL00950:Htt APN 5 34891441 missense probably benign
IGL00953:Htt APN 5 34818677 missense probably benign 0.04
IGL00957:Htt APN 5 34806724 missense probably benign
IGL01314:Htt APN 5 34878856 missense probably benign
IGL01412:Htt APN 5 34898572 missense probably damaging 0.98
IGL01510:Htt APN 5 34907512 missense probably damaging 1.00
IGL01617:Htt APN 5 34876755 missense possibly damaging 0.67
IGL01893:Htt APN 5 34876830 missense probably damaging 1.00
IGL01914:Htt APN 5 34829709 missense probably benign
IGL01994:Htt APN 5 34832604 missense possibly damaging 0.83
IGL02102:Htt APN 5 34891481 splice site probably benign
IGL02381:Htt APN 5 34829760 missense probably benign 0.03
IGL02529:Htt APN 5 34819043 splice site probably benign
IGL02678:Htt APN 5 34899902 missense probably damaging 1.00
IGL02707:Htt APN 5 34829881 critical splice donor site probably null
IGL02731:Htt APN 5 34803793 missense probably benign 0.41
IGL02931:Htt APN 5 34876753 missense probably damaging 1.00
IGL03167:Htt APN 5 34818986 missense probably damaging 0.98
IGL03343:Htt APN 5 34826041 missense probably benign
IGL03344:Htt APN 5 34907466 missense probably benign 0.02
IGL03344:Htt APN 5 34879828 missense probably benign 0.39
IGL03366:Htt APN 5 34907580 missense probably damaging 1.00
IGL03410:Htt APN 5 34799445 missense probably damaging 0.99
Chalk UTSW 5 34907086 missense possibly damaging 0.86
IGL02796:Htt UTSW 5 34877482 missense probably benign 0.43
PIT4377001:Htt UTSW 5 34875965 missense probably benign 0.10
R0013:Htt UTSW 5 34820104 missense probably benign 0.25
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0056:Htt UTSW 5 34826078 splice site probably benign
R0207:Htt UTSW 5 34896908 missense probably benign 0.11
R0329:Htt UTSW 5 34817134 splice site probably benign
R0494:Htt UTSW 5 34821844 missense possibly damaging 0.73
R0548:Htt UTSW 5 34870746 missense probably damaging 1.00
R0601:Htt UTSW 5 34846003 missense probably benign 0.08
R0799:Htt UTSW 5 34817753 missense probably benign 0.00
R0947:Htt UTSW 5 34898924 missense probably damaging 1.00
R1053:Htt UTSW 5 34851217 critical splice acceptor site probably null
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1478:Htt UTSW 5 34803827 missense probably damaging 0.99
R1573:Htt UTSW 5 34864374 splice site probably benign
R1677:Htt UTSW 5 34828574 missense probably damaging 1.00
R1792:Htt UTSW 5 34907199 missense probably damaging 1.00
R1816:Htt UTSW 5 34803740 missense probably benign 0.01
R1833:Htt UTSW 5 34905748 splice site probably benign
R1837:Htt UTSW 5 34819023 missense probably benign 0.00
R1846:Htt UTSW 5 34848944 missense probably damaging 0.98
R1875:Htt UTSW 5 34794112 missense probably benign 0.05
R1899:Htt UTSW 5 34907085 missense probably benign 0.01
R2013:Htt UTSW 5 34852871 missense probably damaging 0.99
R2062:Htt UTSW 5 34825982 missense probably benign 0.00
R2064:Htt UTSW 5 34825982 missense probably benign 0.00
R2067:Htt UTSW 5 34825982 missense probably benign 0.00
R2068:Htt UTSW 5 34825982 missense probably benign 0.00
R2131:Htt UTSW 5 34877109 missense possibly damaging 0.50
R2162:Htt UTSW 5 34821718 missense probably benign 0.44
R2169:Htt UTSW 5 34877475 missense probably benign 0.08
R2345:Htt UTSW 5 34826004 missense possibly damaging 0.80
R2433:Htt UTSW 5 34907541 missense possibly damaging 0.65
R3027:Htt UTSW 5 34820095 missense possibly damaging 0.85
R3123:Htt UTSW 5 34804531 missense probably benign
R3125:Htt UTSW 5 34804531 missense probably benign
R3717:Htt UTSW 5 34811522 splice site probably benign
R3758:Htt UTSW 5 34895970 missense probably damaging 0.97
R3805:Htt UTSW 5 34877204 splice site probably null
R3833:Htt UTSW 5 34821718 missense probably benign 0.44
R4066:Htt UTSW 5 34878847 missense probably benign
R4272:Htt UTSW 5 34849069 missense possibly damaging 0.96
R4625:Htt UTSW 5 34829785 missense probably damaging 0.99
R4634:Htt UTSW 5 34875948 missense probably benign 0.06
R4655:Htt UTSW 5 34906132 missense probably benign 0.06
R4679:Htt UTSW 5 34820080 missense probably benign
R4684:Htt UTSW 5 34852765 missense probably damaging 1.00
R4832:Htt UTSW 5 34824840 missense probably benign 0.01
R4833:Htt UTSW 5 34852225 missense probably damaging 0.98
R4973:Htt UTSW 5 34813023 missense probably damaging 0.99
R5095:Htt UTSW 5 34824395 missense possibly damaging 0.89
R5132:Htt UTSW 5 34905679 missense possibly damaging 0.89
R5351:Htt UTSW 5 34803833 missense probably damaging 0.99
R5361:Htt UTSW 5 34907584 missense possibly damaging 0.47
R5399:Htt UTSW 5 34877151 missense probably damaging 0.98
R5462:Htt UTSW 5 34885507 nonsense probably null
R5552:Htt UTSW 5 34821774 missense probably benign
R5566:Htt UTSW 5 34849075 missense probably damaging 1.00
R5595:Htt UTSW 5 34905397 missense probably damaging 0.96
R5617:Htt UTSW 5 34870806 missense possibly damaging 0.77
R5835:Htt UTSW 5 34813190 missense probably benign 0.16
R5891:Htt UTSW 5 34870823 missense possibly damaging 0.62
R6158:Htt UTSW 5 34907086 missense possibly damaging 0.86
R6159:Htt UTSW 5 34804676 missense probably benign 0.08
R6169:Htt UTSW 5 34907473 missense probably damaging 1.00
R6242:Htt UTSW 5 34846012 missense probably damaging 1.00
R6274:Htt UTSW 5 34852087 missense possibly damaging 0.81
R6280:Htt UTSW 5 34870759 missense probably benign 0.00
R6294:Htt UTSW 5 34821826 missense probably benign
R6331:Htt UTSW 5 34895887 missense possibly damaging 0.89
R6448:Htt UTSW 5 34875992 missense probably benign 0.05
R6474:Htt UTSW 5 34824895 missense probably benign 0.06
R6592:Htt UTSW 5 34877044 missense possibly damaging 0.92
R6818:Htt UTSW 5 34782767 missense probably damaging 0.99
R6830:Htt UTSW 5 34834326 missense possibly damaging 0.82
R6920:Htt UTSW 5 34877100 missense probably null 1.00
R6962:Htt UTSW 5 34899771 critical splice acceptor site probably null
R7057:Htt UTSW 5 34821723 missense probably null 0.05
R7144:Htt UTSW 5 34846006 missense probably damaging 1.00
R7329:Htt UTSW 5 34829755 missense probably benign 0.03
R7378:Htt UTSW 5 34803799 missense probably benign 0.04
R7418:Htt UTSW 5 34790353 missense possibly damaging 0.55
R7495:Htt UTSW 5 34811477 missense probably benign 0.00
R7554:Htt UTSW 5 34864740 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGAGTCTGATAGCTGTCTCTCATG -3'
(R):5'- GCATCTCGACTGAAACTCTAGTG -3'

Sequencing Primer
(F):5'- GATAGCTGTCTCTCATGAGTCATTTC -3'
(R):5'- CTCGACTGAAACTCTAGTGGTCAG -3'
Posted On2019-06-26