Incidental Mutation 'R7166:Itpr1'
ID557935
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Possibly essential (E-score: 0.715) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108378190 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 481 (V481I)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000203936]
PDB Structure
Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032192
AA Change: V481I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: V481I

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: V481I

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: V481I

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203936
SMART Domains Protein: ENSMUSP00000145526
Gene: ENSMUSG00000030102

DomainStartEndE-ValueType
MIR 5 61 1.3e-11 SMART
MIR 68 162 1.6e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCAGTTGTATTATGCAGCTCCG -3'
(R):5'- AGTCCATCCTCCAAGTCTTAGGG -3'

Sequencing Primer
(F):5'- GCTCCGTTAGCCCCAGC -3'
(R):5'- TTTGTATGAGCACGGATCCCACAG -3'
Posted On2019-06-26