Incidental Mutation 'R0587:Olfr1259'
ID55794
Institutional Source Beutler Lab
Gene Symbol Olfr1259
Ensembl Gene ENSMUSG00000068806
Gene Nameolfactory receptor 1259
SynonymsGA_x6K02T2Q125-51376062-51375133, MOR232-9
MMRRC Submission 038777-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0587 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89940532-89948664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89943392 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 241 (H241R)
Ref Sequence ENSEMBL: ENSMUSP00000149652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090695] [ENSMUST00000214846]
Predicted Effect probably damaging
Transcript: ENSMUST00000090695
AA Change: H241R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088194
Gene: ENSMUSG00000068806
AA Change: H241R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 8.9e-45 PFAM
Pfam:7tm_1 39 285 5.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214846
AA Change: H241R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik T C 17: 35,892,963 *212W probably null Het
Abca1 A G 4: 53,107,035 Y231H probably benign Het
Abca5 T G 11: 110,311,377 I401L probably benign Het
Ak2 A G 4: 129,002,378 D112G probably damaging Het
Ankrd60 T A 2: 173,568,851 D292V possibly damaging Het
Bank1 A G 3: 136,214,037 probably benign Het
Bod1l G A 5: 41,821,637 S778L probably benign Het
Cep76 C A 18: 67,623,175 E529* probably null Het
Col24a1 T C 3: 145,293,145 V13A possibly damaging Het
Ctsc T A 7: 88,297,229 H154Q probably benign Het
Ctsf A G 19: 4,855,738 E87G probably benign Het
Dmxl1 A T 18: 49,935,307 T2716S probably benign Het
Espl1 A G 15: 102,303,947 probably benign Het
Fuk T A 8: 110,883,325 Q1019L probably damaging Het
Hnrnpul1 T A 7: 25,745,232 Y217F possibly damaging Het
Kmt2a A T 9: 44,847,534 M1039K probably damaging Het
Large1 T C 8: 72,859,333 N382D probably damaging Het
Madd A G 2: 91,146,885 V1402A probably damaging Het
Mlh3 C T 12: 85,266,419 V998M probably benign Het
Myo1c A G 11: 75,657,790 Y71C probably damaging Het
Myt1l G A 12: 29,811,635 D139N unknown Het
Nes C A 3: 87,978,569 H1378Q probably benign Het
Otud6b T C 4: 14,815,661 E243G probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pcm1 G T 8: 41,286,051 R912L probably damaging Het
Piezo2 A G 18: 63,022,426 I2449T possibly damaging Het
Slc12a5 G A 2: 164,976,533 M217I probably damaging Het
Sorl1 C A 9: 41,984,506 W1784C probably damaging Het
Spatc1l A G 10: 76,564,177 R178G possibly damaging Het
Strada A C 11: 106,170,964 Y154D probably damaging Het
Syt6 A G 3: 103,625,571 T424A probably damaging Het
Tbx1 C T 16: 18,583,493 A245T possibly damaging Het
Tmem143 T C 7: 45,907,054 L161P probably damaging Het
Other mutations in Olfr1259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1259 APN 2 89943260 missense probably damaging 0.96
IGL01446:Olfr1259 APN 2 89943938 missense probably damaging 0.99
IGL01830:Olfr1259 APN 2 89943431 missense probably benign 0.03
IGL02160:Olfr1259 APN 2 89943805 missense probably damaging 1.00
PIT4280001:Olfr1259 UTSW 2 89943743 missense probably damaging 1.00
R0366:Olfr1259 UTSW 2 89943818 missense possibly damaging 0.89
R0550:Olfr1259 UTSW 2 89943389 missense probably damaging 0.99
R1383:Olfr1259 UTSW 2 89943551 missense probably benign 0.12
R1400:Olfr1259 UTSW 2 89943542 missense possibly damaging 0.82
R1851:Olfr1259 UTSW 2 89943814 nonsense probably null
R1953:Olfr1259 UTSW 2 89943923 missense probably damaging 1.00
R2330:Olfr1259 UTSW 2 89943953 missense probably benign
R3897:Olfr1259 UTSW 2 89943809 missense probably benign 0.24
R3955:Olfr1259 UTSW 2 89943828 missense possibly damaging 0.90
R4687:Olfr1259 UTSW 2 89943869 missense probably damaging 0.98
R4976:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5119:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5291:Olfr1259 UTSW 2 89943436 nonsense probably null
R5415:Olfr1259 UTSW 2 89943387 missense probably benign 0.25
R5546:Olfr1259 UTSW 2 89943585 missense probably damaging 1.00
R5588:Olfr1259 UTSW 2 89943792 missense probably benign 0.00
R6633:Olfr1259 UTSW 2 89943366 missense probably benign
R6858:Olfr1259 UTSW 2 89943743 missense probably damaging 0.99
R7294:Olfr1259 UTSW 2 89943724 nonsense probably null
Z1088:Olfr1259 UTSW 2 89943770 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGGTCCTGAACTCTAAAGTGAAGG -3'
(R):5'- GTTGGAACTTGTTTGCATGGACACAC -3'

Sequencing Primer
(F):5'- AAGATTCCGTGTGTGTCCC -3'
(R):5'- TGTTTGCATGGACACACACATC -3'
Posted On2013-07-11