Incidental Mutation 'R7166:Slc1a6'
ID557943
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78812812 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 456 (T456S)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005490
AA Change: T456S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: T456S

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
IGL03046:Slc1a6 UTSW 10 78800174 missense probably benign 0.19
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
R7292:Slc1a6 UTSW 10 78814604 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CCCAGCATCACACATTTTGC -3'
(R):5'- CTGTCCTTGCAAAATCCTTTAGG -3'

Sequencing Primer
(F):5'- GCATCACACATTTTGCTTTCATGATG -3'
(R):5'- GTCCAGGGTTAAACCCAA -3'
Posted On2019-06-26