Incidental Mutation 'R7166:Ercc8'
ID557953
Institutional Source Beutler Lab
Gene Symbol Ercc8
Ensembl Gene ENSMUSG00000021694
Gene Nameexcision repaiross-complementing rodent repair deficiency, complementation group 8
Synonyms2810431L23Rik, 4631412O06Rik, B130065P18Rik, 2410022P04Rik, Csa, Ckn1
MMRRC Submission
Accession Numbers

Genbank: NM_028042

Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location108158731-108195364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108169433 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 114 (M114K)
Ref Sequence ENSEMBL: ENSMUSP00000059211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054835] [ENSMUST00000120672] [ENSMUST00000123182] [ENSMUST00000123657] [ENSMUST00000129117] [ENSMUST00000133957] [ENSMUST00000142931] [ENSMUST00000152634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054835
AA Change: M114K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059211
Gene: ENSMUSG00000021694
AA Change: M114K

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
WD40 175 215 2.71e-10 SMART
WD40 234 273 9.24e-4 SMART
WD40 323 362 7.5e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120672
AA Change: M114K

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112746
Gene: ENSMUSG00000021694
AA Change: M114K

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Blast:WD40 137 172 6e-6 BLAST
low complexity region 186 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123138
SMART Domains Protein: ENSMUSP00000119212
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 2 54 4e-29 PDB
Blast:WD40 28 54 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123182
SMART Domains Protein: ENSMUSP00000121777
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123657
SMART Domains Protein: ENSMUSP00000117492
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129117
SMART Domains Protein: ENSMUSP00000116507
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133957
SMART Domains Protein: ENSMUSP00000116226
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 54 3e-30 PDB
Blast:WD40 28 54 2e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000142931
AA Change: M114K

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118154
Gene: ENSMUSG00000021694
AA Change: M114K

DomainStartEndE-ValueType
WD40 35 72 3.21e-1 SMART
WD40 81 128 9.75e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152634
SMART Domains Protein: ENSMUSP00000122802
Gene: ENSMUSG00000021694

DomainStartEndE-ValueType
PDB:4A11|B 1 57 9e-32 PDB
Blast:WD40 31 57 2e-11 BLAST
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutation of this gene results in skin photosensitivity, increased incidence of skin tumors after UV exposure, and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Ercc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Ercc8 APN 13 108169459 missense probably damaging 1.00
IGL02074:Ercc8 APN 13 108158784 unclassified probably benign
B5639:Ercc8 UTSW 13 108160723 missense probably damaging 0.96
R0620:Ercc8 UTSW 13 108174061 critical splice donor site probably null
R1909:Ercc8 UTSW 13 108175566 nonsense probably null
R2509:Ercc8 UTSW 13 108183717 splice site probably benign
R2967:Ercc8 UTSW 13 108160714 missense probably damaging 1.00
R3857:Ercc8 UTSW 13 108194114 missense possibly damaging 0.82
R4941:Ercc8 UTSW 13 108160767 unclassified probably benign
R5585:Ercc8 UTSW 13 108175589 missense probably damaging 0.99
R6023:Ercc8 UTSW 13 108178577 missense probably damaging 1.00
R6363:Ercc8 UTSW 13 108183870 missense probably damaging 1.00
R6483:Ercc8 UTSW 13 108183810 missense probably damaging 0.99
R6825:Ercc8 UTSW 13 108158809 missense probably damaging 0.97
R7151:Ercc8 UTSW 13 108187282 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCCTTCAGAGCAGCTAAAAC -3'
(R):5'- CGCAGAAGTTAGTTAACCAGGG -3'

Sequencing Primer
(F):5'- GATGTGTGATCCTACTGTAGAAATCC -3'
(R):5'- GTTAGTTAACCAGGGTATAACTCTCC -3'
Posted On2019-06-26