Incidental Mutation 'R7166:Rab2b'
ID557955
Institutional Source Beutler Lab
Gene Symbol Rab2b
Ensembl Gene ENSMUSG00000022159
Gene NameRAB2B, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52261759-52279545 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 52279345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022765] [ENSMUST00000022766] [ENSMUST00000100631] [ENSMUST00000167116] [ENSMUST00000172488] [ENSMUST00000174020]
Predicted Effect probably benign
Transcript: ENSMUST00000022765
SMART Domains Protein: ENSMUSP00000022765
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
RAB 7 170 7.66e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022766
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100631
SMART Domains Protein: ENSMUSP00000098197
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
RAB 7 168 6.88e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167116
SMART Domains Protein: ENSMUSP00000131145
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
RAB 7 170 7.66e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172488
SMART Domains Protein: ENSMUSP00000133787
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
Pfam:Miro 8 62 3.5e-7 PFAM
Pfam:Ras 8 62 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172634
Predicted Effect probably benign
Transcript: ENSMUST00000174020
SMART Domains Protein: ENSMUSP00000134726
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
small_GTPase 7 70 5.2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Rab protein family are nontransforming monomeric GTP-binding proteins of the Ras superfamily that contain 4 highly conserved regions involved in GTP binding and hydrolysis. Rab proteins are prenylated, membrane-bound proteins involved in vesicular fusion and trafficking; see MIM 179508.[supplied by OMIM, Apr 2006]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc26a2 A T 18: 61,198,829 M510K possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Rab2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Rab2b APN 14 52268696 missense probably damaging 0.99
R4631:Rab2b UTSW 14 52266242 missense possibly damaging 0.86
R6418:Rab2b UTSW 14 52268707 utr 3 prime probably benign
R7006:Rab2b UTSW 14 52266233 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCGATTTTGGAGGTAGGATCC -3'
(R):5'- GATGATTGGACCGAGTCAGG -3'

Sequencing Primer
(F):5'- GTAGGATCCCCGCCCCAAC -3'
(R):5'- GGACGCAACCAGTCTCGATC -3'
Posted On2019-06-26