Incidental Mutation 'R7166:Slc26a2'
ID557961
Institutional Source Beutler Lab
Gene Symbol Slc26a2
Ensembl Gene ENSMUSG00000034320
Gene Namesolute carrier family 26 (sulfate transporter), member 2
SynonymsDtd, ST-OB
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R7166 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61192919-61211612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61198829 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 510 (M510K)
Ref Sequence ENSEMBL: ENSMUSP00000119447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037603] [ENSMUST00000146409] [ENSMUST00000148829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037603
AA Change: M275K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040163
Gene: ENSMUSG00000034320
AA Change: M275K

DomainStartEndE-ValueType
Pfam:Sulfate_transp 1 279 5.8e-83 PFAM
low complexity region 317 330 N/A INTRINSIC
Pfam:STAS 334 480 5.8e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146409
AA Change: M510K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119447
Gene: ENSMUSG00000034320
AA Change: M510K

DomainStartEndE-ValueType
Pfam:Sulfate_transp 108 518 1.8e-133 PFAM
low complexity region 552 565 N/A INTRINSIC
Pfam:STAS 569 715 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148829
SMART Domains Protein: ENSMUSP00000114419
Gene: ENSMUSG00000034320

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 93 176 1.1e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The diastrophic dysplasia sulfate transporter is a transmembrane glycoprotein implicated in the pathogenesis of several human chondrodysplasias. It apparently is critical in cartilage for sulfation of proteoglycans and matrix organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit premature death, stunted growth, joint contractures, and skeletal dysplasia including kyphosis, shorter osteoporotic long bones, aberrant chondrocyte size, delayed endochondral bone ossification, and impairedchondrocyte proliferation and sulfate uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambn T C 5: 88,467,528 L272P possibly damaging Het
Ash2l C A 8: 25,827,320 G335V probably damaging Het
Atp13a1 T A 8: 69,799,316 probably null Het
Atp13a2 G A 4: 141,006,984 R1139Q possibly damaging Het
Atxn2 T A 5: 121,796,397 N886K possibly damaging Het
Celsr3 G T 9: 108,842,951 C2512F probably damaging Het
Cfap221 A G 1: 119,948,113 V449A probably benign Het
Cfhr2 A T 1: 139,831,101 C70* probably null Het
Chfr C A 5: 110,158,805 P472Q probably benign Het
Crybg2 G A 4: 134,060,882 R22Q probably damaging Het
Eef2k T C 7: 120,884,772 F244L probably damaging Het
Efcab11 A T 12: 99,883,355 M23K Het
Ercc8 T A 13: 108,169,433 M114K possibly damaging Het
Fam217a T C 13: 34,910,315 Y487C probably benign Het
Farsb T C 1: 78,471,184 N205S probably benign Het
Glra1 A G 11: 55,515,078 F370S probably benign Het
Gm12258 T A 11: 58,858,473 M158K Het
Gm14305 T A 2: 176,720,943 H209Q probably damaging Het
Gm4924 A T 10: 82,378,201 Q611L unknown Het
Gm5580 A G 6: 116,551,368 I69V probably benign Het
Haus6 T C 4: 86,583,687 E649G possibly damaging Het
Hist1h4j A G 13: 21,735,151 H19R unknown Het
Hlcs C T 16: 94,262,726 D345N possibly damaging Het
Htt C A 5: 34,852,894 Q1564K probably benign Het
Itpr1 G A 6: 108,378,190 V481I probably benign Het
Jak3 T C 8: 71,682,316 I531T probably damaging Het
Kng1 T A 16: 23,079,678 H609Q probably benign Het
Mdn1 T A 4: 32,746,446 S4131T probably damaging Het
Npnt A G 3: 132,948,128 S31P probably damaging Het
Olfr1098 T A 2: 86,922,748 K261N probably damaging Het
Olfr1186 A T 2: 88,525,646 Q21L possibly damaging Het
Olfr398 A T 11: 73,984,295 F104L possibly damaging Het
Paxx A T 2: 25,460,226 L123Q probably damaging Het
Prdm13 C T 4: 21,683,528 R144Q unknown Het
Rab2b C A 14: 52,279,345 probably benign Het
Rnf207 A G 4: 152,311,780 I509T probably damaging Het
Ropn1l T C 15: 31,453,509 Q12R Het
Ryr3 T G 2: 112,875,028 Y847S probably damaging Het
Slc1a6 A T 10: 78,812,812 T456S possibly damaging Het
Slc5a9 T C 4: 111,883,839 T537A probably benign Het
Slc9b2 T C 3: 135,326,178 Y132H unknown Het
Sltm T C 9: 70,584,850 L725S probably damaging Het
Spz1 A G 13: 92,575,927 C14R probably benign Het
Srrm4 T A 5: 116,471,242 Q172L unknown Het
Synj2bp T C 12: 81,504,515 D92G probably benign Het
Tmem169 A C 1: 72,301,070 T220P probably benign Het
Ttn T A 2: 76,888,028 I7270F unknown Het
Txndc16 T G 14: 45,183,154 N137H probably benign Het
Ubr5 A G 15: 37,976,145 Y2499H Het
Ugt2b38 T C 5: 87,410,446 D452G probably damaging Het
Zfp12 T A 5: 143,245,502 I560N possibly damaging Het
Zfp60 A G 7: 27,749,512 K535R possibly damaging Het
Zfp960 T A 17: 17,088,499 C492S probably damaging Het
Other mutations in Slc26a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slc26a2 APN 18 61198740 missense probably benign 0.05
IGL01570:Slc26a2 APN 18 61198260 missense possibly damaging 0.80
IGL01800:Slc26a2 APN 18 61201729 nonsense probably null
IGL02131:Slc26a2 APN 18 61198812 missense possibly damaging 0.69
IGL02277:Slc26a2 APN 18 61198980 missense probably damaging 1.00
IGL02438:Slc26a2 APN 18 61202217 missense possibly damaging 0.46
IGL03338:Slc26a2 APN 18 61198902 missense probably damaging 1.00
IGL03377:Slc26a2 APN 18 61198586 missense probably damaging 1.00
R0029:Slc26a2 UTSW 18 61202310 missense possibly damaging 0.73
R0531:Slc26a2 UTSW 18 61198379 missense probably damaging 1.00
R1929:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R2115:Slc26a2 UTSW 18 61198824 missense possibly damaging 0.71
R2272:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R2921:Slc26a2 UTSW 18 61201935 missense probably damaging 0.99
R4184:Slc26a2 UTSW 18 61198832 missense probably benign 0.01
R4765:Slc26a2 UTSW 18 61199486 missense probably damaging 0.97
R4812:Slc26a2 UTSW 18 61202021 missense probably damaging 1.00
R4948:Slc26a2 UTSW 18 61198258 nonsense probably null
R4960:Slc26a2 UTSW 18 61198803 missense probably damaging 1.00
R5107:Slc26a2 UTSW 18 61198560 missense probably damaging 1.00
R6120:Slc26a2 UTSW 18 61199417 missense possibly damaging 0.64
R6147:Slc26a2 UTSW 18 61201685 missense probably damaging 1.00
R6914:Slc26a2 UTSW 18 61199279 missense probably damaging 0.97
R6996:Slc26a2 UTSW 18 61201854 missense probably damaging 1.00
R7529:Slc26a2 UTSW 18 61198358 missense probably damaging 1.00
X0003:Slc26a2 UTSW 18 61199195 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAAACCTTGATGCCGGAC -3'
(R):5'- AAGAGTCAACAGGCTGCCAG -3'

Sequencing Primer
(F):5'- TGATGCCGGACTTGCTCC -3'
(R):5'- TGCCAGACGCAGCTGTCAG -3'
Posted On2019-06-26