Incidental Mutation 'R7167:Rtp3'
ID557996
Institutional Source Beutler Lab
Gene Symbol Rtp3
Ensembl Gene ENSMUSG00000066319
Gene Namereceptor transporter protein 3
SynonymsTmem7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7167 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110984935-110990583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110986704 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 198 (T198S)
Ref Sequence ENSEMBL: ENSMUSP00000081985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035076] [ENSMUST00000084922] [ENSMUST00000198702] [ENSMUST00000199891]
Predicted Effect probably benign
Transcript: ENSMUST00000035076
SMART Domains Protein: ENSMUSP00000035076
Gene: ENSMUSG00000032495

DomainStartEndE-ValueType
Blast:LRR 143 165 5e-7 BLAST
LRR_TYP 166 189 4.87e-4 SMART
LRR 236 258 1.41e1 SMART
LRR 259 282 2.27e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084922
AA Change: T198S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000081985
Gene: ENSMUSG00000066319
AA Change: T198S

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198702
SMART Domains Protein: ENSMUSP00000143100
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
Pfam:zf-3CxxC 52 81 2.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199891
SMART Domains Protein: ENSMUSP00000143305
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,647,971 V436A probably benign Het
Abcc5 T C 16: 20,405,501 T111A possibly damaging Het
Acsbg2 T A 17: 56,857,000 D203V probably benign Het
Alpk2 G T 18: 65,306,978 T448K probably benign Het
Arhgef2 A G 3: 88,643,872 N780S possibly damaging Het
Atxn2l T C 7: 126,499,222 N252S possibly damaging Het
Bmpr1b A T 3: 141,863,080 L163Q probably benign Het
Clca2 T C 3: 145,097,784 R100G probably benign Het
Col2a1 A G 15: 98,000,456 I79T unknown Het
Csmd1 A G 8: 15,926,524 V2898A probably benign Het
Cux1 G A 5: 136,310,041 probably null Het
Cyp2u1 A G 3: 131,303,124 S2P probably benign Het
Daam1 C A 12: 71,988,904 H958N probably damaging Het
Dnah7a C T 1: 53,503,776 V2412I probably benign Het
Ergic2 T C 6: 148,206,635 R2G probably damaging Het
Fam159b A G 13: 104,863,658 V19A probably damaging Het
Fat2 T C 11: 55,285,001 T1629A possibly damaging Het
Ftl1 T A 7: 45,459,778 probably benign Het
Fut8 T C 12: 77,448,632 V332A possibly damaging Het
Gm28363 T C 1: 117,727,389 S113P probably damaging Het
Gm6502 G A 5: 94,317,125 A457T possibly damaging Het
Hfe A T 13: 23,708,069 V104E probably damaging Het
Ifih1 A T 2: 62,598,896 N899K probably benign Het
Krt75 A G 15: 101,568,315 S380P possibly damaging Het
Meiob T G 17: 24,836,445 F409V probably damaging Het
Mkrn2os A T 6: 115,585,513 I163N probably damaging Het
Nanos1 G T 19: 60,756,608 G115W probably damaging Het
Naprt C T 15: 75,892,612 A276T probably damaging Het
Oas1e G T 5: 120,795,422 T26N probably benign Het
Olfr1179 A G 2: 88,402,208 V242A possibly damaging Het
Olfr1279 T C 2: 111,306,448 M81T probably benign Het
Olfr355 T C 2: 36,927,521 I198V probably benign Het
Olfr53 T A 7: 140,652,553 C191* probably null Het
Olfr766-ps1 T G 10: 129,063,272 Q245P probably damaging Het
Olfr792 T C 10: 129,540,738 L67P possibly damaging Het
Olfr967 T C 9: 39,750,569 F61S probably damaging Het
Oog2 T G 4: 144,195,175 D218E probably benign Het
Optn T C 2: 5,042,483 N207S probably benign Het
Oxnad1 G T 14: 32,101,019 E236* probably null Het
Pcdha3 G A 18: 36,946,993 A263T probably damaging Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Pip5k1b T A 19: 24,397,069 E49D probably benign Het
Plau C A 14: 20,839,450 F194L possibly damaging Het
Ppm1n A G 7: 19,279,741 L95S probably damaging Het
Radil G T 5: 142,485,505 probably null Het
Ralgapa2 C T 2: 146,348,454 M1266I probably benign Het
Reln A T 5: 21,942,620 L2444Q probably damaging Het
Rims2 T C 15: 39,437,077 V260A probably benign Het
Rnase2b T A 14: 51,162,765 V101E probably damaging Het
Smad3 T A 9: 63,666,153 D201V probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spata7 T G 12: 98,664,296 F371C probably damaging Het
Stag1 T G 9: 100,945,889 N990K probably benign Het
Tbx18 C T 9: 87,707,830 A352T probably damaging Het
Thada C T 17: 84,230,963 R1539Q probably benign Het
Thrap3 A C 4: 126,185,127 probably benign Het
Tnks G A 8: 34,849,304 T887M probably damaging Het
Trap1 A C 16: 4,052,928 V393G probably damaging Het
Trpm4 A G 7: 45,327,719 probably null Het
Trrap G T 5: 144,839,614 G3007C probably benign Het
U2surp A T 9: 95,481,673 N611K probably damaging Het
Usp12 A G 5: 146,768,935 probably null Het
Vmn1r200 A G 13: 22,395,317 T97A possibly damaging Het
Vmn2r110 C T 17: 20,574,179 V743I probably benign Het
Vps50 C T 6: 3,600,256 T905M probably damaging Het
Wdr48 T A 9: 119,907,789 probably null Het
Zfp446 C T 7: 12,978,122 probably benign Het
Zfr T C 15: 12,180,929 S1012P probably benign Het
Other mutations in Rtp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Rtp3 APN 9 110986598 missense probably benign 0.03
IGL02212:Rtp3 APN 9 110987321 splice site probably benign
IGL03033:Rtp3 APN 9 110986094 unclassified probably benign
R0392:Rtp3 UTSW 9 110989553 missense probably damaging 0.98
R0529:Rtp3 UTSW 9 110987084 missense possibly damaging 0.93
R0645:Rtp3 UTSW 9 110987100 missense probably damaging 0.97
R1282:Rtp3 UTSW 9 110986920 missense probably benign 0.01
R1609:Rtp3 UTSW 9 110986017 unclassified probably benign
R1649:Rtp3 UTSW 9 110986704 missense probably benign 0.00
R1662:Rtp3 UTSW 9 110986683 missense probably benign 0.23
R2011:Rtp3 UTSW 9 110986034 unclassified probably benign
R3697:Rtp3 UTSW 9 110987194 missense possibly damaging 0.86
R4661:Rtp3 UTSW 9 110986451 unclassified probably null
R4707:Rtp3 UTSW 9 110986211 unclassified probably benign
R4764:Rtp3 UTSW 9 110987350 intron probably benign
R4796:Rtp3 UTSW 9 110986454 missense probably benign 0.00
R4839:Rtp3 UTSW 9 110989476 missense probably damaging 1.00
R5262:Rtp3 UTSW 9 110986127 unclassified probably benign
R5886:Rtp3 UTSW 9 110987136 missense probably damaging 1.00
R5932:Rtp3 UTSW 9 110986692 missense probably benign 0.04
R6089:Rtp3 UTSW 9 110986973 missense probably benign 0.00
R6545:Rtp3 UTSW 9 110986826 missense possibly damaging 0.83
R6812:Rtp3 UTSW 9 110987112 missense probably benign 0.14
R6895:Rtp3 UTSW 9 110987196 missense possibly damaging 0.72
R7023:Rtp3 UTSW 9 110986646 missense probably benign 0.00
R7113:Rtp3 UTSW 9 110986699 missense probably damaging 0.98
R7171:Rtp3 UTSW 9 110985941 missense unknown
R7359:Rtp3 UTSW 9 110986296 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGAAATGTTGCTACAGGTGAC -3'
(R):5'- AGGTCACTGTCACCTGTAGC -3'

Sequencing Primer
(F):5'- TTGCTACAGGTGACAGTGACC -3'
(R):5'- ACTGTCACCTGTAGCAACATTTC -3'
Posted On2019-06-26