Incidental Mutation 'R7167:Rims2'
ID558012
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R7167 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39437077 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 260 (V260A)
Ref Sequence ENSEMBL: ENSMUSP00000048719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243] [ENSMUST00000228839]
Predicted Effect probably benign
Transcript: ENSMUST00000042917
AA Change: V260A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: V260A

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082054
AA Change: V300A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: V300A

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227243
AA Change: V260A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000228839
AA Change: V68A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,647,971 V436A probably benign Het
Abcc5 T C 16: 20,405,501 T111A possibly damaging Het
Acsbg2 T A 17: 56,857,000 D203V probably benign Het
Alpk2 G T 18: 65,306,978 T448K probably benign Het
Arhgef2 A G 3: 88,643,872 N780S possibly damaging Het
Atxn2l T C 7: 126,499,222 N252S possibly damaging Het
Bmpr1b A T 3: 141,863,080 L163Q probably benign Het
Clca2 T C 3: 145,097,784 R100G probably benign Het
Col2a1 A G 15: 98,000,456 I79T unknown Het
Csmd1 A G 8: 15,926,524 V2898A probably benign Het
Daam1 C A 12: 71,988,904 H958N probably damaging Het
Dnah7a C T 1: 53,503,776 V2412I probably benign Het
Ergic2 T C 6: 148,206,635 R2G probably damaging Het
Fam159b A G 13: 104,863,658 V19A probably damaging Het
Fat2 T C 11: 55,285,001 T1629A possibly damaging Het
Ftl1 T A 7: 45,459,778 probably benign Het
Fut8 T C 12: 77,448,632 V332A possibly damaging Het
Gm28363 T C 1: 117,727,389 S113P probably damaging Het
Gm6502 G A 5: 94,317,125 A457T possibly damaging Het
Hfe A T 13: 23,708,069 V104E probably damaging Het
Ifih1 A T 2: 62,598,896 N899K probably benign Het
Krt75 A G 15: 101,568,315 S380P possibly damaging Het
Meiob T G 17: 24,836,445 F409V probably damaging Het
Mkrn2os A T 6: 115,585,513 I163N probably damaging Het
Nanos1 G T 19: 60,756,608 G115W probably damaging Het
Naprt C T 15: 75,892,612 A276T probably damaging Het
Oas1e G T 5: 120,795,422 T26N probably benign Het
Olfr1179 A G 2: 88,402,208 V242A possibly damaging Het
Olfr1279 T C 2: 111,306,448 M81T probably benign Het
Olfr355 T C 2: 36,927,521 I198V probably benign Het
Olfr53 T A 7: 140,652,553 C191* probably null Het
Olfr766-ps1 T G 10: 129,063,272 Q245P probably damaging Het
Olfr792 T C 10: 129,540,738 L67P possibly damaging Het
Olfr967 T C 9: 39,750,569 F61S probably damaging Het
Oog2 T G 4: 144,195,175 D218E probably benign Het
Optn T C 2: 5,042,483 N207S probably benign Het
Oxnad1 G T 14: 32,101,019 E236* probably null Het
Pcdha3 G A 18: 36,946,993 A263T probably damaging Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Pip5k1b T A 19: 24,397,069 E49D probably benign Het
Plau C A 14: 20,839,450 F194L possibly damaging Het
Ppm1n A G 7: 19,279,741 L95S probably damaging Het
Ralgapa2 C T 2: 146,348,454 M1266I probably benign Het
Reln A T 5: 21,942,620 L2444Q probably damaging Het
Rnase2b T A 14: 51,162,765 V101E probably damaging Het
Rtp3 T A 9: 110,986,704 T198S probably benign Het
Smad3 T A 9: 63,666,153 D201V probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spata7 T G 12: 98,664,296 F371C probably damaging Het
Stag1 T G 9: 100,945,889 N990K probably benign Het
Tbx18 C T 9: 87,707,830 A352T probably damaging Het
Thada C T 17: 84,230,963 R1539Q probably benign Het
Tnks G A 8: 34,849,304 T887M probably damaging Het
Trap1 A C 16: 4,052,928 V393G probably damaging Het
Trpm4 A G 7: 45,327,719 probably null Het
Trrap G T 5: 144,839,614 G3007C probably benign Het
U2surp A T 9: 95,481,673 N611K probably damaging Het
Usp12 A G 5: 146,768,935 probably null Het
Vmn1r200 A G 13: 22,395,317 T97A possibly damaging Het
Vmn2r110 C T 17: 20,574,179 V743I probably benign Het
Vps50 C T 6: 3,600,256 T905M probably damaging Het
Wdr48 T A 9: 119,907,789 probably null Het
Zfp446 C T 7: 12,978,122 probably benign Het
Zfr T C 15: 12,180,929 S1012P probably benign Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6502:Rims2 UTSW 15 39534855 missense probably benign 0.42
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
R7217:Rims2 UTSW 15 39476489 missense probably damaging 0.99
R7223:Rims2 UTSW 15 39437032 missense probably benign 0.30
R7289:Rims2 UTSW 15 39437718 missense probably benign 0.00
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGATCTGCTTGAATTTATCCACCC -3'
(R):5'- TGGATCACTTCTGTAGCGTGC -3'

Sequencing Primer
(F):5'- CCCATTTGGCAGTGAATCAG -3'
(R):5'- GTAGCGTGCCTGGTATTCCTC -3'
Posted On2019-06-26