Incidental Mutation 'R7168:Olfr1163'
ID558035
Institutional Source Beutler Lab
Gene Symbol Olfr1163
Ensembl Gene ENSMUSG00000075137
Gene Nameolfactory receptor 1163
SynonymsMOR174-8, GA_x6K02T2Q125-49563265-49562315
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7168 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88069817-88071830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88070577 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 268 (N268K)
Ref Sequence ENSEMBL: ENSMUSP00000149399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099835] [ENSMUST00000215268]
Predicted Effect probably benign
Transcript: ENSMUST00000099835
AA Change: N268K

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097423
Gene: ENSMUSG00000075137
AA Change: N268K

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-44 PFAM
Pfam:7tm_1 43 292 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215268
AA Change: N268K

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2810474O19Rik T G 6: 149,327,843 F796V probably benign Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Arid3b A T 9: 57,805,535 D232E probably benign Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Deaf1 C T 7: 141,324,596 probably benign Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Impact T A 18: 12,986,313 probably null Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kansl2 T C 15: 98,529,544 probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Kpna1 A G 16: 36,015,962 probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in Olfr1163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Olfr1163 APN 2 88071124 missense possibly damaging 0.56
IGL01472:Olfr1163 APN 2 88070978 missense possibly damaging 0.56
IGL02111:Olfr1163 APN 2 88071227 missense probably benign 0.22
R1274:Olfr1163 UTSW 2 88070595 missense probably damaging 1.00
R1938:Olfr1163 UTSW 2 88070956 missense probably damaging 1.00
R2012:Olfr1163 UTSW 2 88070719 missense probably benign 0.03
R3056:Olfr1163 UTSW 2 88071239 missense probably benign
R4127:Olfr1163 UTSW 2 88071235 missense probably benign 0.00
R4748:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4749:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4769:Olfr1163 UTSW 2 88070729 missense probably benign 0.25
R6647:Olfr1163 UTSW 2 88070709 missense probably benign 0.03
R7111:Olfr1163 UTSW 2 88070656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCATGGTAGAGAGAAACAGCC -3'
(R):5'- TATACACATTCCCAGCCTGC -3'

Sequencing Primer
(F):5'- GCTCAGTGAAGTTGGAAC -3'
(R):5'- GCAACCTTCAATGAAGTGAGTAC -3'
Posted On2019-06-26