Incidental Mutation 'R7168:2810474O19Rik'
ID558050
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7168 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 149327843 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 796 (F796V)
Ref Sequence ENSEMBL: ENSMUSP00000041180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably benign
Transcript: ENSMUST00000046689
AA Change: F796V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: F796V

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100765
AA Change: F796V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: F796V

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably benign
Transcript: ENSMUST00000189837
AA Change: F796V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: F796V

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189932
AA Change: F796V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: F796V

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
AA Change: F796V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: F796V

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,216,057 D1388V probably damaging Het
2900026A02Rik C A 5: 113,137,793 R65L probably damaging Het
Abcb10 A T 8: 123,966,611 L318Q Het
Abhd18 T A 3: 40,934,936 V417D probably damaging Het
Actl7a A G 4: 56,743,769 K99E probably benign Het
Adam2 A T 14: 66,058,792 I206N possibly damaging Het
Adgrv1 G T 13: 81,397,209 S5652R possibly damaging Het
Aebp2 C T 6: 140,633,700 T221M probably damaging Het
Ahi1 T A 10: 21,017,932 M854K probably benign Het
Alpi T A 1: 87,099,433 T375S possibly damaging Het
Apip T A 2: 103,092,468 C210* probably null Het
Asic5 G A 3: 82,011,975 C342Y probably damaging Het
BC035947 T C 1: 78,499,593 M101V probably benign Het
Brd3 G A 2: 27,454,399 R440C possibly damaging Het
Eif2ak3 A G 6: 70,881,626 T300A probably benign Het
Eml6 T A 11: 29,838,529 I519F probably benign Het
Fat4 T C 3: 38,980,659 F2820S probably damaging Het
Fcho2 A G 13: 98,789,463 I132T probably benign Het
Garnl3 A G 2: 32,995,078 V810A probably damaging Het
Gm14403 A C 2: 177,509,525 Q179P probably damaging Het
Gm3127 A G 14: 4,172,501 M251V probably benign Het
Hook3 A G 8: 26,071,086 S298P probably benign Het
Itgal T C 7: 127,330,213 F1101L probably benign Het
Itih1 C T 14: 30,934,107 R579Q probably null Het
Kng1 A G 16: 23,079,641 D597G probably benign Het
Lama2 C T 10: 27,366,152 probably null Het
Ltbp1 G T 17: 75,291,366 C614F probably damaging Het
Luc7l3 T C 11: 94,299,984 E168G unknown Het
Lvrn A C 18: 46,881,322 K525T probably benign Het
Mdn1 G A 4: 32,719,184 R2249H probably damaging Het
Mmp16 G T 4: 18,110,550 G449C probably damaging Het
Mst1r T C 9: 107,908,193 V350A probably benign Het
Muc5b A G 7: 141,864,017 M3567V probably benign Het
Mybl1 A T 1: 9,678,288 L361Q probably damaging Het
Myom1 T A 17: 71,089,947 S1063R probably benign Het
Notch4 A C 17: 34,572,693 H582P probably benign Het
Nwd2 T A 5: 63,807,494 C1474S probably benign Het
Olfr1163 A C 2: 88,070,577 N268K probably benign Het
Olfr1284 A T 2: 111,379,879 D293V probably damaging Het
Olfr1338 A T 4: 118,753,851 I231N probably damaging Het
Olfr889 G T 9: 38,116,663 S294I probably damaging Het
Pcmt1 A T 10: 7,638,182 V241D probably damaging Het
Plcl1 T A 1: 55,697,463 N654K probably damaging Het
Plg G A 17: 12,388,559 G121D probably damaging Het
Ptch1 A G 13: 63,512,060 S1260P probably benign Het
Pwp1 G T 10: 85,884,537 R346I probably damaging Het
R3hdm1 C T 1: 128,216,495 T800I probably benign Het
Rab3gap2 A G 1: 185,204,297 D19G possibly damaging Het
Slc1a3 G T 15: 8,645,902 N206K possibly damaging Het
Slc6a3 T C 13: 73,571,472 V540A probably benign Het
Sntb1 G A 15: 55,791,265 P265S probably benign Het
Timm29 T C 9: 21,593,453 V139A probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tm2d3 T A 7: 65,693,926 V56E probably benign Het
Trhr2 T A 8: 122,360,537 T55S probably damaging Het
Trim17 T G 11: 58,968,578 V206G probably benign Het
Trpm1 A G 7: 64,268,697 N1479S probably benign Het
Trpv2 T A 11: 62,583,088 C190S probably benign Het
Umod A T 7: 119,478,326 probably benign Het
Usp34 T A 11: 23,464,585 Y2862N Het
Vmn1r158 A G 7: 22,790,676 V36A possibly damaging Het
Zfp420 A G 7: 29,875,366 Y337C probably damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTGTACAGATGTTCCTCATG -3'
(R):5'- CAGACACATTACTAGTTTTACCACCAG -3'

Sequencing Primer
(F):5'- TCATGAGGTCCCTGAGCAG -3'
(R):5'- TTACCACCAGTTTGATTTTCTACG -3'
Posted On2019-06-26