Incidental Mutation 'R7169:Dpm1'
List |< first << previous [record 15 of 69] next >> last >|
ID558104
Institutional Source Beutler Lab
Gene Symbol Dpm1
Ensembl Gene ENSMUSG00000078919
Gene Namedolichol-phosphate (beta-D) mannosyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7169 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location168209048-168230591 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 168211423 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 207 (Y207*)
Ref Sequence ENSEMBL: ENSMUSP00000118776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000109193] [ENSMUST00000138667] [ENSMUST00000154111]
Predicted Effect probably benign
Transcript: ENSMUST00000057793
SMART Domains Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088001
SMART Domains Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149

DomainStartEndE-ValueType
ZnF_C2H2 74 97 6.57e0 SMART
ZnF_C2H2 107 129 1.77e1 SMART
low complexity region 130 141 N/A INTRINSIC
ZnF_C2H2 165 188 1.29e1 SMART
ZnF_C2H2 221 244 1.4e1 SMART
low complexity region 423 437 N/A INTRINSIC
ZnF_C2H2 446 468 8.62e1 SMART
ZnF_C2H2 488 509 2.54e1 SMART
ZnF_C2H2 511 534 1.03e-2 SMART
low complexity region 582 596 N/A INTRINSIC
ZnF_C2H2 621 646 1.27e2 SMART
HOX 756 817 2.95e-6 SMART
low complexity region 957 970 N/A INTRINSIC
low complexity region 1012 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099072
SMART Domains Protein: ENSMUSP00000096671
Gene: ENSMUSG00000078919

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 16 118 1.8e-11 PFAM
Pfam:Glyco_tranf_2_2 20 119 1.3e-8 PFAM
Pfam:Glycos_transf_2 20 119 6.3e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109193
AA Change: Y155*
SMART Domains Protein: ENSMUSP00000104816
Gene: ENSMUSG00000078919
AA Change: Y155*

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_2 2 101 1.2e-8 PFAM
Pfam:Glycos_transf_2 2 147 7.8e-36 PFAM
Pfam:Glyco_tranf_2_3 2 187 1.2e-11 PFAM
Pfam:Glyco_transf_21 34 148 1.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138667
AA Change: Y207*
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752
AA Change: Y207*

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154111
AA Change: Y207*
SMART Domains Protein: ENSMUSP00000118776
Gene: ENSMUSG00000078919
AA Change: Y207*

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 241 3.2e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 7.6e-10 PFAM
Pfam:Glycos_transf_2 28 199 8.1e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. Human DPM1 lacks a carboxy-terminal transmembrane domain and signal sequence and is regulated by DPM2. Mutations in this gene are associated with congenital disorder of glycosylation type Ie. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,204,928 V870A probably damaging Het
Ahi1 T G 10: 21,055,019 D919E probably damaging Het
Angptl6 T A 9: 20,875,179 R390S probably damaging Het
Arhgef11 A G 3: 87,727,448 I873V possibly damaging Het
BC024063 T C 10: 82,110,459 Y638H possibly damaging Het
Brsk1 T C 7: 4,715,404 S751P probably benign Het
Cdh20 G A 1: 104,947,353 A287T possibly damaging Het
Clic3 G A 2: 25,458,719 R237H probably benign Het
Cog6 G T 3: 52,989,966 P562H possibly damaging Het
Csnk2a2 A G 8: 95,488,378 Y24H Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Dennd6b A T 15: 89,188,852 F161I possibly damaging Het
Dnah14 G T 1: 181,702,365 V2235L probably benign Het
Dnah6 A T 6: 73,038,746 V3636D probably damaging Het
Eml3 A G 19: 8,933,464 T227A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eppk1 C A 15: 76,105,914 A2256S probably benign Het
Etnppl A T 3: 130,620,696 N80I probably damaging Het
Eya4 A T 10: 23,155,947 N236K probably benign Het
Fam26e T A 10: 34,092,164 T298S probably damaging Het
Fam49a A G 12: 12,359,232 D71G possibly damaging Het
Fam84a A G 12: 14,150,618 F36S probably damaging Het
Gm12886 T G 4: 121,416,751 Q89H probably damaging Het
Gsdme T C 6: 50,227,378 T200A probably benign Het
Hipk1 C T 3: 103,744,217 A1122T probably benign Het
Icos A G 1: 60,995,546 D176G probably damaging Het
Igkv5-43 T A 6: 69,823,535 Y56F probably damaging Het
Il1r1 T C 1: 40,293,359 probably null Het
Ildr2 G A 1: 166,307,934 probably null Het
Ilf3 T A 9: 21,395,426 H305Q probably damaging Het
Insrr A G 3: 87,808,594 H532R probably benign Het
Lmbr1l CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC 15: 98,909,158 probably null Het
Lmbr1l ACTACAT ACTACATGCTACAT 15: 98,909,194 probably benign Het
Lrrc25 T G 8: 70,617,787 S73A probably benign Het
Lrrn1 T C 6: 107,567,604 L121P probably damaging Het
Ly6c1 C A 15: 75,044,646 V116L probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Mroh7 T A 4: 106,691,639 D1009V probably damaging Het
Mybpc3 T C 2: 91,118,179 V4A possibly damaging Het
Mycbp2 A G 14: 103,260,200 S979P possibly damaging Het
Ntn5 C T 7: 45,686,774 R210* probably null Het
Nuak1 T C 10: 84,374,745 D493G probably damaging Het
Olfr1281 T A 2: 111,328,598 Y60N probably damaging Het
Olfr1306 A G 2: 111,912,594 M112T possibly damaging Het
Olfr211 G T 6: 116,494,064 A152S probably benign Het
Olfr680-ps1 T C 7: 105,091,190 I150V possibly damaging Het
Oprk1 T A 1: 5,589,081 D11E probably benign Het
Pkd1l2 T A 8: 117,040,835 T1239S possibly damaging Het
Pkm A G 9: 59,671,625 D296G possibly damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pop5 T A 5: 115,240,228 V77E possibly damaging Het
Ppp1r10 T C 17: 35,929,473 S552P probably damaging Het
Rabggta C G 14: 55,720,901 R101P probably damaging Het
Rorc A T 3: 94,389,180 E243V probably benign Het
Setmar C A 6: 108,065,088 A3E possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc12a7 G A 13: 73,784,560 V56M probably benign Het
Snph T A 2: 151,594,387 N207I probably damaging Het
Snx14 A G 9: 88,398,309 V531A probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr3 A T 8: 45,397,019 M871K probably damaging Het
Tnfrsf11a A T 1: 105,844,695 R569S possibly damaging Het
Trim66 A G 7: 109,455,121 V1294A probably benign Het
Vldlr G A 19: 27,244,328 V698I probably benign Het
Vmn2r73 G A 7: 85,858,455 Q550* probably null Het
Zdhhc5 A T 2: 84,702,331 probably null Het
Zfhx3 T A 8: 108,951,398 Y3027N possibly damaging Het
Zfp663 C T 2: 165,352,439 S620N probably benign Het
Other mutations in Dpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Dpm1 APN 2 168210575 missense probably benign 0.37
PIT4531001:Dpm1 UTSW 2 168210552 missense probably benign 0.42
R0200:Dpm1 UTSW 2 168223155 critical splice acceptor site probably null
R0212:Dpm1 UTSW 2 168227494 missense probably benign 0.00
R1460:Dpm1 UTSW 2 168210629 missense probably damaging 1.00
R1889:Dpm1 UTSW 2 168217735 missense possibly damaging 0.67
R1974:Dpm1 UTSW 2 168217747 missense probably damaging 1.00
R4547:Dpm1 UTSW 2 168223153 missense probably damaging 0.98
R4838:Dpm1 UTSW 2 168210536 missense probably damaging 1.00
R4887:Dpm1 UTSW 2 168217759 missense probably benign 0.01
R6919:Dpm1 UTSW 2 168230275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTCAAATACACCGATCTAAATG -3'
(R):5'- TCCTTCATGGCTAAGGGAGG -3'

Sequencing Primer
(F):5'- CCGATCTAAATGGTCACCTTTTAGGG -3'
(R):5'- CATGGCTAAGGGAGGGGCTC -3'
Posted On2019-06-26