Incidental Mutation 'R7169:Pop5'
List |< first << previous [record 52 of 69] next >> last >|
ID558113
Institutional Source Beutler Lab
Gene Symbol Pop5
Ensembl Gene ENSMUSG00000060152
Gene Nameprocessing of precursor 5, ribonuclease P/MRP family (S. cerevisiae)
Synonyms2700077E03Rik, 1500019J17Rik, Rnasep3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7169 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location115235836-115245351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115240228 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 77 (V77E)
Ref Sequence ENSEMBL: ENSMUSP00000080215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000081497] [ENSMUST00000112096] [ENSMUST00000112097] [ENSMUST00000135455]
Predicted Effect probably benign
Transcript: ENSMUST00000040555
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081497
AA Change: V77E

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080215
Gene: ENSMUSG00000060152
AA Change: V77E

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 115 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112096
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112097
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135455
AA Change: V77E

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118408
Gene: ENSMUSG00000060152
AA Change: V77E

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 117 3.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139853
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,204,928 V870A probably damaging Het
Ahi1 T G 10: 21,055,019 D919E probably damaging Het
Angptl6 T A 9: 20,875,179 R390S probably damaging Het
Arhgef11 A G 3: 87,727,448 I873V possibly damaging Het
BC024063 T C 10: 82,110,459 Y638H possibly damaging Het
Brsk1 T C 7: 4,715,404 S751P probably benign Het
Cdh20 G A 1: 104,947,353 A287T possibly damaging Het
Clic3 G A 2: 25,458,719 R237H probably benign Het
Cog6 G T 3: 52,989,966 P562H possibly damaging Het
Csnk2a2 A G 8: 95,488,378 Y24H Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Dennd6b A T 15: 89,188,852 F161I possibly damaging Het
Dnah14 G T 1: 181,702,365 V2235L probably benign Het
Dnah6 A T 6: 73,038,746 V3636D probably damaging Het
Dpm1 A T 2: 168,211,423 Y207* probably null Het
Eml3 A G 19: 8,933,464 T227A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eppk1 C A 15: 76,105,914 A2256S probably benign Het
Etnppl A T 3: 130,620,696 N80I probably damaging Het
Eya4 A T 10: 23,155,947 N236K probably benign Het
Fam26e T A 10: 34,092,164 T298S probably damaging Het
Fam49a A G 12: 12,359,232 D71G possibly damaging Het
Fam84a A G 12: 14,150,618 F36S probably damaging Het
Gm12886 T G 4: 121,416,751 Q89H probably damaging Het
Gsdme T C 6: 50,227,378 T200A probably benign Het
Hipk1 C T 3: 103,744,217 A1122T probably benign Het
Icos A G 1: 60,995,546 D176G probably damaging Het
Igkv5-43 T A 6: 69,823,535 Y56F probably damaging Het
Il1r1 T C 1: 40,293,359 probably null Het
Ildr2 G A 1: 166,307,934 probably null Het
Ilf3 T A 9: 21,395,426 H305Q probably damaging Het
Insrr A G 3: 87,808,594 H532R probably benign Het
Lmbr1l CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC 15: 98,909,158 probably null Het
Lmbr1l ACTACAT ACTACATGCTACAT 15: 98,909,194 probably benign Het
Lrrc25 T G 8: 70,617,787 S73A probably benign Het
Lrrn1 T C 6: 107,567,604 L121P probably damaging Het
Ly6c1 C A 15: 75,044,646 V116L probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Mroh7 T A 4: 106,691,639 D1009V probably damaging Het
Mybpc3 T C 2: 91,118,179 V4A possibly damaging Het
Mycbp2 A G 14: 103,260,200 S979P possibly damaging Het
Ntn5 C T 7: 45,686,774 R210* probably null Het
Nuak1 T C 10: 84,374,745 D493G probably damaging Het
Olfr1281 T A 2: 111,328,598 Y60N probably damaging Het
Olfr1306 A G 2: 111,912,594 M112T possibly damaging Het
Olfr211 G T 6: 116,494,064 A152S probably benign Het
Olfr680-ps1 T C 7: 105,091,190 I150V possibly damaging Het
Oprk1 T A 1: 5,589,081 D11E probably benign Het
Pkd1l2 T A 8: 117,040,835 T1239S possibly damaging Het
Pkm A G 9: 59,671,625 D296G possibly damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Ppp1r10 T C 17: 35,929,473 S552P probably damaging Het
Rabggta C G 14: 55,720,901 R101P probably damaging Het
Rorc A T 3: 94,389,180 E243V probably benign Het
Setmar C A 6: 108,065,088 A3E possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc12a7 G A 13: 73,784,560 V56M probably benign Het
Snph T A 2: 151,594,387 N207I probably damaging Het
Snx14 A G 9: 88,398,309 V531A probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr3 A T 8: 45,397,019 M871K probably damaging Het
Tnfrsf11a A T 1: 105,844,695 R569S possibly damaging Het
Trim66 A G 7: 109,455,121 V1294A probably benign Het
Vldlr G A 19: 27,244,328 V698I probably benign Het
Vmn2r73 G A 7: 85,858,455 Q550* probably null Het
Zdhhc5 A T 2: 84,702,331 probably null Het
Zfhx3 T A 8: 108,951,398 Y3027N possibly damaging Het
Zfp663 C T 2: 165,352,439 S620N probably benign Het
Other mutations in Pop5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Pop5 APN 5 115240559 unclassified probably benign
R0127:Pop5 UTSW 5 115240171 missense probably damaging 1.00
R2045:Pop5 UTSW 5 115238212 missense possibly damaging 0.94
R3744:Pop5 UTSW 5 115240508 missense possibly damaging 0.80
R4408:Pop5 UTSW 5 115240777 unclassified probably benign
R5458:Pop5 UTSW 5 115240437 unclassified probably benign
R5607:Pop5 UTSW 5 115240201 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAGCCTCAGATGACTTTCG -3'
(R):5'- GACAATGGCTTGTGAAACGG -3'

Sequencing Primer
(F):5'- TTCCGAGCTGAGCTGTAACAC -3'
(R):5'- CAATGGCTTGTGAAACGGTTACC -3'
Posted On2019-06-26