Incidental Mutation 'R7169:Pkd1l2'
List |< first << previous [record 49 of 69] next >> last >|
ID558130
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Namepolycystic kidney disease 1 like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7169 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location116995679-117082449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117040835 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1239 (T1239S)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098375
AA Change: T1238S

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: T1238S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109093
AA Change: T1239S

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: T1239S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153724
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,204,928 V870A probably damaging Het
Ahi1 T G 10: 21,055,019 D919E probably damaging Het
Angptl6 T A 9: 20,875,179 R390S probably damaging Het
Arhgef11 A G 3: 87,727,448 I873V possibly damaging Het
BC024063 T C 10: 82,110,459 Y638H possibly damaging Het
Brsk1 T C 7: 4,715,404 S751P probably benign Het
Cdh20 G A 1: 104,947,353 A287T possibly damaging Het
Clic3 G A 2: 25,458,719 R237H probably benign Het
Cog6 G T 3: 52,989,966 P562H possibly damaging Het
Csnk2a2 A G 8: 95,488,378 Y24H Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Dennd6b A T 15: 89,188,852 F161I possibly damaging Het
Dnah14 G T 1: 181,702,365 V2235L probably benign Het
Dnah6 A T 6: 73,038,746 V3636D probably damaging Het
Dpm1 A T 2: 168,211,423 Y207* probably null Het
Eml3 A G 19: 8,933,464 T227A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eppk1 C A 15: 76,105,914 A2256S probably benign Het
Etnppl A T 3: 130,620,696 N80I probably damaging Het
Eya4 A T 10: 23,155,947 N236K probably benign Het
Fam26e T A 10: 34,092,164 T298S probably damaging Het
Fam49a A G 12: 12,359,232 D71G possibly damaging Het
Fam84a A G 12: 14,150,618 F36S probably damaging Het
Gm12886 T G 4: 121,416,751 Q89H probably damaging Het
Gsdme T C 6: 50,227,378 T200A probably benign Het
Hipk1 C T 3: 103,744,217 A1122T probably benign Het
Icos A G 1: 60,995,546 D176G probably damaging Het
Igkv5-43 T A 6: 69,823,535 Y56F probably damaging Het
Il1r1 T C 1: 40,293,359 probably null Het
Ildr2 G A 1: 166,307,934 probably null Het
Ilf3 T A 9: 21,395,426 H305Q probably damaging Het
Insrr A G 3: 87,808,594 H532R probably benign Het
Lmbr1l CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC 15: 98,909,158 probably null Het
Lmbr1l ACTACAT ACTACATGCTACAT 15: 98,909,194 probably benign Het
Lrrc25 T G 8: 70,617,787 S73A probably benign Het
Lrrn1 T C 6: 107,567,604 L121P probably damaging Het
Ly6c1 C A 15: 75,044,646 V116L probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Mroh7 T A 4: 106,691,639 D1009V probably damaging Het
Mybpc3 T C 2: 91,118,179 V4A possibly damaging Het
Mycbp2 A G 14: 103,260,200 S979P possibly damaging Het
Ntn5 C T 7: 45,686,774 R210* probably null Het
Nuak1 T C 10: 84,374,745 D493G probably damaging Het
Olfr1281 T A 2: 111,328,598 Y60N probably damaging Het
Olfr1306 A G 2: 111,912,594 M112T possibly damaging Het
Olfr211 G T 6: 116,494,064 A152S probably benign Het
Olfr680-ps1 T C 7: 105,091,190 I150V possibly damaging Het
Oprk1 T A 1: 5,589,081 D11E probably benign Het
Pkm A G 9: 59,671,625 D296G possibly damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pop5 T A 5: 115,240,228 V77E possibly damaging Het
Ppp1r10 T C 17: 35,929,473 S552P probably damaging Het
Rabggta C G 14: 55,720,901 R101P probably damaging Het
Rorc A T 3: 94,389,180 E243V probably benign Het
Setmar C A 6: 108,065,088 A3E possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc12a7 G A 13: 73,784,560 V56M probably benign Het
Snph T A 2: 151,594,387 N207I probably damaging Het
Snx14 A G 9: 88,398,309 V531A probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr3 A T 8: 45,397,019 M871K probably damaging Het
Tnfrsf11a A T 1: 105,844,695 R569S possibly damaging Het
Trim66 A G 7: 109,455,121 V1294A probably benign Het
Vldlr G A 19: 27,244,328 V698I probably benign Het
Vmn2r73 G A 7: 85,858,455 Q550* probably null Het
Zdhhc5 A T 2: 84,702,331 probably null Het
Zfhx3 T A 8: 108,951,398 Y3027N possibly damaging Het
Zfp663 C T 2: 165,352,439 S620N probably benign Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117028479 missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117030682 missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117068110 missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117060594 missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117065529 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGCCAGAGACATCGTGC -3'
(R):5'- GTCTGATACCACATAGCCAATAAGG -3'

Sequencing Primer
(F):5'- CCAGAGACATCGTGCCAGAG -3'
(R):5'- TAGCCAATAAGGACATGAGCCCTTC -3'
Posted On2019-06-26