Incidental Mutation 'R7169:Eya4'
List |< first << previous [record 20 of 69] next >> last >|
ID558136
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7169 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23155947 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 236 (N236K)
Ref Sequence ENSEMBL: ENSMUSP00000090335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000218049] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably benign
Transcript: ENSMUST00000074366
AA Change: N236K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: N236K

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000092665
AA Change: N236K

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: N236K

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000218049
Predicted Effect possibly damaging
Transcript: ENSMUST00000219315
AA Change: N259K

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000220299
AA Change: N236K

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,204,928 V870A probably damaging Het
Ahi1 T G 10: 21,055,019 D919E probably damaging Het
Angptl6 T A 9: 20,875,179 R390S probably damaging Het
Arhgef11 A G 3: 87,727,448 I873V possibly damaging Het
BC024063 T C 10: 82,110,459 Y638H possibly damaging Het
Brsk1 T C 7: 4,715,404 S751P probably benign Het
Cdh20 G A 1: 104,947,353 A287T possibly damaging Het
Clic3 G A 2: 25,458,719 R237H probably benign Het
Cog6 G T 3: 52,989,966 P562H possibly damaging Het
Csnk2a2 A G 8: 95,488,378 Y24H Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Dennd6b A T 15: 89,188,852 F161I possibly damaging Het
Dnah14 G T 1: 181,702,365 V2235L probably benign Het
Dnah6 A T 6: 73,038,746 V3636D probably damaging Het
Dpm1 A T 2: 168,211,423 Y207* probably null Het
Eml3 A G 19: 8,933,464 T227A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eppk1 C A 15: 76,105,914 A2256S probably benign Het
Etnppl A T 3: 130,620,696 N80I probably damaging Het
Fam26e T A 10: 34,092,164 T298S probably damaging Het
Fam49a A G 12: 12,359,232 D71G possibly damaging Het
Fam84a A G 12: 14,150,618 F36S probably damaging Het
Gm12886 T G 4: 121,416,751 Q89H probably damaging Het
Gsdme T C 6: 50,227,378 T200A probably benign Het
Hipk1 C T 3: 103,744,217 A1122T probably benign Het
Icos A G 1: 60,995,546 D176G probably damaging Het
Igkv5-43 T A 6: 69,823,535 Y56F probably damaging Het
Il1r1 T C 1: 40,293,359 probably null Het
Ildr2 G A 1: 166,307,934 probably null Het
Ilf3 T A 9: 21,395,426 H305Q probably damaging Het
Insrr A G 3: 87,808,594 H532R probably benign Het
Lmbr1l ACTACAT ACTACATGCTACAT 15: 98,909,194 probably benign Het
Lmbr1l CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC 15: 98,909,158 probably null Het
Lrrc25 T G 8: 70,617,787 S73A probably benign Het
Lrrn1 T C 6: 107,567,604 L121P probably damaging Het
Ly6c1 C A 15: 75,044,646 V116L probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Mroh7 T A 4: 106,691,639 D1009V probably damaging Het
Mybpc3 T C 2: 91,118,179 V4A possibly damaging Het
Mycbp2 A G 14: 103,260,200 S979P possibly damaging Het
Ntn5 C T 7: 45,686,774 R210* probably null Het
Nuak1 T C 10: 84,374,745 D493G probably damaging Het
Olfr1281 T A 2: 111,328,598 Y60N probably damaging Het
Olfr1306 A G 2: 111,912,594 M112T possibly damaging Het
Olfr211 G T 6: 116,494,064 A152S probably benign Het
Olfr680-ps1 T C 7: 105,091,190 I150V possibly damaging Het
Oprk1 T A 1: 5,589,081 D11E probably benign Het
Pkd1l2 T A 8: 117,040,835 T1239S possibly damaging Het
Pkm A G 9: 59,671,625 D296G possibly damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Pop5 T A 5: 115,240,228 V77E possibly damaging Het
Ppp1r10 T C 17: 35,929,473 S552P probably damaging Het
Rabggta C G 14: 55,720,901 R101P probably damaging Het
Rorc A T 3: 94,389,180 E243V probably benign Het
Setmar C A 6: 108,065,088 A3E possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc12a7 G A 13: 73,784,560 V56M probably benign Het
Snph T A 2: 151,594,387 N207I probably damaging Het
Snx14 A G 9: 88,398,309 V531A probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr3 A T 8: 45,397,019 M871K probably damaging Het
Tnfrsf11a A T 1: 105,844,695 R569S possibly damaging Het
Trim66 A G 7: 109,455,121 V1294A probably benign Het
Vldlr G A 19: 27,244,328 V698I probably benign Het
Vmn2r73 G A 7: 85,858,455 Q550* probably null Het
Zdhhc5 A T 2: 84,702,331 probably null Het
Zfhx3 T A 8: 108,951,398 Y3027N possibly damaging Het
Zfp663 C T 2: 165,352,439 S620N probably benign Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense not run
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTCAGAAGTGTACCAAGGAAGAG -3'
(R):5'- GCACTGATTTCTTGAGTTGCC -3'

Sequencing Primer
(F):5'- TACCAAGGAAGAGAGAGGGTTTTAC -3'
(R):5'- GCCTGCATTCTTCACATAATGGAG -3'
Posted On2019-06-26