Incidental Mutation 'R7169:Pof1b'
ID558158
Institutional Source Beutler Lab
Gene Symbol Pof1b
Ensembl Gene ENSMUSG00000034607
Gene Namepremature ovarian failure 1B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7169 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location112638431-112698651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112644345 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 544 (I544T)
Ref Sequence ENSEMBL: ENSMUSP00000047655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039887]
Predicted Effect probably benign
Transcript: ENSMUST00000039887
AA Change: I544T

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047655
Gene: ENSMUSG00000034607
AA Change: I544T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 25 44 N/A INTRINSIC
low complexity region 183 217 N/A INTRINSIC
coiled coil region 331 441 N/A INTRINSIC
coiled coil region 463 529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Premature ovarian failure (POF) is characterized by primary or secondary amenorrhea in women less than 40 years old. Two POF susceptibility regions called "POF1" and "POF2" have been identified by breakpoint mapping of X-autosome translocations. POF1 extends from Xq21-qter while POF2 extends from Xq13.3 to Xq21.1. This gene, POF1B, resides in the POF2 region. This gene is expressed at trace levels in mouse prenatal ovary and is barely detectable or absent from adult ovary, in human and in the mouse respectively. This gene's expression is restricted to epithelia with its highest expression in the epidermis, and oro-pharyngeal and gastro-intestinal tracts. The protein encoded by this gene binds non-muscle actin filaments. The role this gene may play in the etiology of premature ovarian failure remains to be determined. [provided by RefSeq, Jan 2010]
PHENOTYPE: Both male and female mice homozygous for a targeted knockout mutation of this gene are viable and fertile have no reported abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 A G 10: 61,204,928 V870A probably damaging Het
Ahi1 T G 10: 21,055,019 D919E probably damaging Het
Angptl6 T A 9: 20,875,179 R390S probably damaging Het
Arhgef11 A G 3: 87,727,448 I873V possibly damaging Het
BC024063 T C 10: 82,110,459 Y638H possibly damaging Het
Brsk1 T C 7: 4,715,404 S751P probably benign Het
Cdh20 G A 1: 104,947,353 A287T possibly damaging Het
Clic3 G A 2: 25,458,719 R237H probably benign Het
Cog6 G T 3: 52,989,966 P562H possibly damaging Het
Csnk2a2 A G 8: 95,488,378 Y24H Het
Ctif T C 18: 75,472,016 D484G probably damaging Het
Dennd6b A T 15: 89,188,852 F161I possibly damaging Het
Dnah14 G T 1: 181,702,365 V2235L probably benign Het
Dnah6 A T 6: 73,038,746 V3636D probably damaging Het
Dpm1 A T 2: 168,211,423 Y207* probably null Het
Eml3 A G 19: 8,933,464 T227A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eppk1 C A 15: 76,105,914 A2256S probably benign Het
Etnppl A T 3: 130,620,696 N80I probably damaging Het
Eya4 A T 10: 23,155,947 N236K probably benign Het
Fam26e T A 10: 34,092,164 T298S probably damaging Het
Fam49a A G 12: 12,359,232 D71G possibly damaging Het
Fam84a A G 12: 14,150,618 F36S probably damaging Het
Gm12886 T G 4: 121,416,751 Q89H probably damaging Het
Gsdme T C 6: 50,227,378 T200A probably benign Het
Hipk1 C T 3: 103,744,217 A1122T probably benign Het
Icos A G 1: 60,995,546 D176G probably damaging Het
Igkv5-43 T A 6: 69,823,535 Y56F probably damaging Het
Il1r1 T C 1: 40,293,359 probably null Het
Ildr2 G A 1: 166,307,934 probably null Het
Ilf3 T A 9: 21,395,426 H305Q probably damaging Het
Insrr A G 3: 87,808,594 H532R probably benign Het
Lmbr1l CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC 15: 98,909,158 probably null Het
Lmbr1l ACTACAT ACTACATGCTACAT 15: 98,909,194 probably benign Het
Lrrc25 T G 8: 70,617,787 S73A probably benign Het
Lrrn1 T C 6: 107,567,604 L121P probably damaging Het
Ly6c1 C A 15: 75,044,646 V116L probably benign Het
Meltf A G 16: 31,880,162 D30G probably benign Het
Mroh7 T A 4: 106,691,639 D1009V probably damaging Het
Mybpc3 T C 2: 91,118,179 V4A possibly damaging Het
Mycbp2 A G 14: 103,260,200 S979P possibly damaging Het
Ntn5 C T 7: 45,686,774 R210* probably null Het
Nuak1 T C 10: 84,374,745 D493G probably damaging Het
Olfr1281 T A 2: 111,328,598 Y60N probably damaging Het
Olfr1306 A G 2: 111,912,594 M112T possibly damaging Het
Olfr211 G T 6: 116,494,064 A152S probably benign Het
Olfr680-ps1 T C 7: 105,091,190 I150V possibly damaging Het
Oprk1 T A 1: 5,589,081 D11E probably benign Het
Pkd1l2 T A 8: 117,040,835 T1239S possibly damaging Het
Pkm A G 9: 59,671,625 D296G possibly damaging Het
Pop5 T A 5: 115,240,228 V77E possibly damaging Het
Ppp1r10 T C 17: 35,929,473 S552P probably damaging Het
Rabggta C G 14: 55,720,901 R101P probably damaging Het
Rorc A T 3: 94,389,180 E243V probably benign Het
Setmar C A 6: 108,065,088 A3E possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc12a7 G A 13: 73,784,560 V56M probably benign Het
Snph T A 2: 151,594,387 N207I probably damaging Het
Snx14 A G 9: 88,398,309 V531A probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr3 A T 8: 45,397,019 M871K probably damaging Het
Tnfrsf11a A T 1: 105,844,695 R569S possibly damaging Het
Trim66 A G 7: 109,455,121 V1294A probably benign Het
Vldlr G A 19: 27,244,328 V698I probably benign Het
Vmn2r73 G A 7: 85,858,455 Q550* probably null Het
Zdhhc5 A T 2: 84,702,331 probably null Het
Zfhx3 T A 8: 108,951,398 Y3027N possibly damaging Het
Zfp663 C T 2: 165,352,439 S620N probably benign Het
Other mutations in Pof1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Pof1b APN X 112645237 splice site probably benign
IGL02902:Pof1b APN X 112649112 critical splice acceptor site probably null
IGL03231:Pof1b APN X 112645290 missense possibly damaging 0.52
IGL03246:Pof1b APN X 112648120 missense probably benign
R7170:Pof1b UTSW X 112644345 missense probably benign 0.14
R7171:Pof1b UTSW X 112644345 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GATGGCCCCAATGTCATAAAC -3'
(R):5'- GCCTGTATAGCATTTTGACTACTG -3'

Sequencing Primer
(F):5'- TGGCCCCAATGTCATAAACAACTTTG -3'
(R):5'- AGCATTTTGACTACTGTGTATCAAC -3'
Posted On2019-06-26