Incidental Mutation 'R0587:2310061I04Rik'
List |< first << previous [record 13 of 958] next >> last >|
ID55822
Institutional Source Beutler Lab
Gene Symbol 2310061I04Rik
Ensembl Gene ENSMUSG00000050705
Gene NameRIKEN cDNA 2310061I04 gene
Synonyms
MMRRC Submission 038777-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R0587 (G1)
Quality Score220
Status Validated
Chromosome17
Chromosomal Location35892677-35897431 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 35892963 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 212 (*212W)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025292] [ENSMUST00000061052] [ENSMUST00000077494] [ENSMUST00000146451] [ENSMUST00000148482] [ENSMUST00000148721] [ENSMUST00000149277] [ENSMUST00000150056] [ENSMUST00000156817] [ENSMUST00000174366]
Predicted Effect probably benign
Transcript: ENSMUST00000025292
SMART Domains Protein: ENSMUSP00000025292
Gene: ENSMUSG00000024422

DomainStartEndE-ValueType
Blast:DEXDc 55 310 6e-57 BLAST
DEXDc 400 585 7.26e-33 SMART
HELICc 636 733 1.7e-15 SMART
HA2 794 885 2.24e-31 SMART
Pfam:OB_NTP_bind 901 1018 3.6e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000059740
AA Change: *212W
SMART Domains Protein: ENSMUSP00000050693
Gene: ENSMUSG00000050705
AA Change: *212W

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
Pfam:DUF2358 75 200 5.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061052
SMART Domains Protein: ENSMUSP00000056383
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 74 191 1.5e-53 PFAM
Pfam:Acetyltransf_1 88 157 6.8e-5 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077494
SMART Domains Protein: ENSMUSP00000076703
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2.5e-57 PFAM
low complexity region 232 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126744
SMART Domains Protein: ENSMUSP00000122211
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
Pfam:Mec-17 1 83 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143114
Predicted Effect probably benign
Transcript: ENSMUST00000146451
AA Change: M197V

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115771
Gene: ENSMUSG00000050705
AA Change: M197V

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148482
AA Change: M197V

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114151
Gene: ENSMUSG00000050705
AA Change: M197V

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148721
AA Change: M280V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116278
Gene: ENSMUSG00000050705
AA Change: M280V

DomainStartEndE-ValueType
low complexity region 28 79 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF2358 149 274 1.4e-36 PFAM
low complexity region 289 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149277
SMART Domains Protein: ENSMUSP00000122715
Gene: ENSMUSG00000024426

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Mec-17 72 192 2e-57 PFAM
low complexity region 209 228 N/A INTRINSIC
low complexity region 255 272 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149452
Predicted Effect probably benign
Transcript: ENSMUST00000150056
SMART Domains Protein: ENSMUSP00000121142
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 130 5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154272
Predicted Effect probably benign
Transcript: ENSMUST00000154670
SMART Domains Protein: ENSMUSP00000123547
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
Pfam:DUF2358 2 97 7.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156817
SMART Domains Protein: ENSMUSP00000114851
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 16 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173596
Predicted Effect probably benign
Transcript: ENSMUST00000173967
SMART Domains Protein: ENSMUSP00000133818
Gene: ENSMUSG00000024422

DomainStartEndE-ValueType
Blast:DEXDc 2 83 5e-35 BLAST
PDB:3I4U|A 4 83 6e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174330
Predicted Effect probably benign
Transcript: ENSMUST00000174366
SMART Domains Protein: ENSMUSP00000133888
Gene: ENSMUSG00000024422

DomainStartEndE-ValueType
Blast:DEXDc 55 310 9e-58 BLAST
DEXDc 400 585 7.26e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174449
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,107,035 Y231H probably benign Het
Abca5 T G 11: 110,311,377 I401L probably benign Het
Ak2 A G 4: 129,002,378 D112G probably damaging Het
Ankrd60 T A 2: 173,568,851 D292V possibly damaging Het
Bank1 A G 3: 136,214,037 probably benign Het
Bod1l G A 5: 41,821,637 S778L probably benign Het
Cep76 C A 18: 67,623,175 E529* probably null Het
Col24a1 T C 3: 145,293,145 V13A possibly damaging Het
Ctsc T A 7: 88,297,229 H154Q probably benign Het
Ctsf A G 19: 4,855,738 E87G probably benign Het
Dmxl1 A T 18: 49,935,307 T2716S probably benign Het
Espl1 A G 15: 102,303,947 probably benign Het
Fuk T A 8: 110,883,325 Q1019L probably damaging Het
Hnrnpul1 T A 7: 25,745,232 Y217F possibly damaging Het
Kmt2a A T 9: 44,847,534 M1039K probably damaging Het
Large1 T C 8: 72,859,333 N382D probably damaging Het
Madd A G 2: 91,146,885 V1402A probably damaging Het
Mlh3 C T 12: 85,266,419 V998M probably benign Het
Myo1c A G 11: 75,657,790 Y71C probably damaging Het
Myt1l G A 12: 29,811,635 D139N unknown Het
Nes C A 3: 87,978,569 H1378Q probably benign Het
Olfr1259 T C 2: 89,943,392 H241R probably damaging Het
Otud6b T C 4: 14,815,661 E243G probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pcm1 G T 8: 41,286,051 R912L probably damaging Het
Piezo2 A G 18: 63,022,426 I2449T possibly damaging Het
Slc12a5 G A 2: 164,976,533 M217I probably damaging Het
Sorl1 C A 9: 41,984,506 W1784C probably damaging Het
Spatc1l A G 10: 76,564,177 R178G possibly damaging Het
Strada A C 11: 106,170,964 Y154D probably damaging Het
Syt6 A G 3: 103,625,571 T424A probably damaging Het
Tbx1 C T 16: 18,583,493 A245T possibly damaging Het
Tmem143 T C 7: 45,907,054 L161P probably damaging Het
Other mutations in 2310061I04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0098:2310061I04Rik UTSW 17 35896417 unclassified probably benign
R0432:2310061I04Rik UTSW 17 35895816 missense probably damaging 1.00
R1807:2310061I04Rik UTSW 17 35895069 nonsense probably null
R4675:2310061I04Rik UTSW 17 35892928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGTCCTCAGTGCAGCCTTTC -3'
(R):5'- GAGCTTAGCCCTGATCTTTGGTCC -3'

Sequencing Primer
(F):5'- AGTGCAGCCTTTCACCCAC -3'
(R):5'- GTGGCCTATTGACACTGAAAAC -3'
Posted On2013-07-11