Incidental Mutation 'R7171:Trrap'
ID558260
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7171 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144794049 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 780 (L780Q)
Ref Sequence ENSEMBL: ENSMUSP00000098035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect probably damaging
Transcript: ENSMUST00000038980
AA Change: L780Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: L780Q

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094120
AA Change: L780Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: L780Q

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100467
AA Change: L780Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: L780Q

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: L494Q

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213013
AA Change: L781Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik T C 2: 154,612,977 N154S unknown Het
9530053A07Rik T A 7: 28,154,519 L1636* probably null Het
Ank3 C T 10: 69,992,481 H2327Y Het
Ano6 A G 15: 95,920,291 Y305C probably damaging Het
Apc2 A G 10: 80,315,336 T2075A possibly damaging Het
Arl6 A G 16: 59,623,092 V93A possibly damaging Het
Bcas3 T C 11: 85,583,937 S790P probably damaging Het
Bcl9l C A 9: 44,505,151 H211N probably benign Het
Bptf G T 11: 107,131,407 D172E unknown Het
Card9 T G 2: 26,359,484 I22L possibly damaging Het
Catsperg1 C A 7: 29,185,212 G933V probably damaging Het
Catsperg2 T A 7: 29,705,325 H771L possibly damaging Het
Ccdc66 T C 14: 27,493,272 N281S possibly damaging Het
Cfap54 A T 10: 92,776,210 L3162H probably damaging Het
Clca4a A G 3: 144,958,173 L503P probably benign Het
Cpn1 T C 19: 43,974,031 N160D probably damaging Het
Ctsh T A 9: 90,067,101 I206K probably benign Het
Cyb561d1 G A 3: 108,199,363 T180M probably damaging Het
Dapk1 A T 13: 60,761,785 D1404V probably damaging Het
Dip2c G T 13: 9,506,648 R76L probably benign Het
Dnah7c T C 1: 46,680,738 I2783T probably damaging Het
E130308A19Rik T C 4: 59,690,333 Y56H probably damaging Het
Efemp2 G T 19: 5,480,257 A310S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faap24 G A 7: 35,392,854 Q213* probably null Het
Fam181b G A 7: 93,080,735 G239S possibly damaging Het
Fancm T C 12: 65,101,620 W670R probably damaging Het
Fmnl1 T C 11: 103,190,398 Y357H probably damaging Het
Fryl A T 5: 73,122,310 V215E probably damaging Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fsip2 T A 2: 82,986,227 Y4101* probably null Het
Gcn1l1 G A 5: 115,590,293 V738I probably benign Het
Gdf9 C T 11: 53,437,539 R441C probably damaging Het
Gipc3 C T 10: 81,341,621 G79E probably damaging Het
Gzmf T A 14: 56,205,934 I196L probably benign Het
Hectd1 A T 12: 51,759,297 V1852E probably damaging Het
Hip1r A T 5: 123,995,944 Q256L probably benign Het
Hmgxb4 T C 8: 75,020,262 S405P probably damaging Het
Il9r T A 11: 32,192,671 H294L probably benign Het
Kif12 G A 4: 63,168,694 T331I probably damaging Het
Krtap8-1 A T 16: 89,487,906 M1K probably null Het
Lamc2 A T 1: 153,139,749 C613S probably damaging Het
Lgr4 T A 2: 110,000,969 N314K probably benign Het
Lpcat2 T C 8: 92,909,266 I432T probably benign Het
Mfhas1 T C 8: 35,588,992 V207A probably benign Het
Msh3 T G 13: 92,349,298 T173P probably benign Het
Mup15 T A 4: 61,438,268 M87L probably benign Het
N4bp2 T C 5: 65,808,022 V1138A probably benign Het
Noc2l T C 4: 156,241,722 V422A probably benign Het
Notch3 C T 17: 32,158,962 G74D probably damaging Het
Ocstamp T A 2: 165,398,161 K35I probably benign Het
Olfr360 T C 2: 37,068,388 F28L possibly damaging Het
Olfr459 T G 6: 41,772,027 T91P probably benign Het
Olfr482 A G 7: 108,095,135 V145A probably benign Het
Olfr692 A G 7: 105,368,761 H145R probably benign Het
Plekhh2 T A 17: 84,521,788 V29D probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Rad54l2 C T 9: 106,713,478 R483H probably damaging Het
Rapgef6 T A 11: 54,676,363 D1128E possibly damaging Het
Rhbdl2 T A 4: 123,814,256 I86N possibly damaging Het
Rims1 C A 1: 22,428,489 R68L Het
Rnf157 A G 11: 116,362,373 F70L possibly damaging Het
Rtp3 C T 9: 110,985,941 C452Y unknown Het
S100a14 A T 3: 90,527,762 K27* probably null Het
Scai C T 2: 39,106,936 G282D possibly damaging Het
Sclt1 A T 3: 41,717,760 I132N probably benign Het
Serpinf1 T A 11: 75,417,985 Q2L possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc16a10 C G 10: 40,037,259 E484D probably benign Het
Slc1a5 T A 7: 16,797,538 D489E probably damaging Het
Slx4 C T 16: 3,990,786 R430H probably benign Het
Teddm1b A T 1: 153,874,933 I163F probably damaging Het
Tmem171 A T 13: 98,692,236 C135* probably null Het
Tmem82 C T 4: 141,614,973 R306H possibly damaging Het
Trpm2 A C 10: 77,924,014 L1096R probably damaging Het
Txlnb A G 10: 17,842,984 D521G probably benign Het
Usp7 T C 16: 8,716,526 D59G probably benign Het
Vcan G A 13: 89,725,591 T48I probably damaging Het
Vmn1r45 A G 6: 89,933,334 L218P probably damaging Het
Wdr25 A T 12: 109,024,996 T370S probably damaging Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
R7167:Trrap UTSW 5 144839614 missense probably benign 0.39
R7205:Trrap UTSW 5 144842707 missense possibly damaging 0.94
R7215:Trrap UTSW 5 144797135 missense probably benign 0.05
R7255:Trrap UTSW 5 144858954 missense probably damaging 1.00
R7261:Trrap UTSW 5 144845477 missense possibly damaging 0.67
R7264:Trrap UTSW 5 144814523 missense probably benign 0.05
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGAGCCCTAGACTCCCAG -3'
(R):5'- GGAAAGTCCAACATGGTTTGATGAC -3'

Sequencing Primer
(F):5'- AGGCACTCCCTGACCTGAC -3'
(R):5'- GTCCAACATGGTTTGATGACAGAAAC -3'
Posted On2019-06-26