Incidental Mutation 'R7171:Serpinf1'
ID558288
Institutional Source Beutler Lab
Gene Symbol Serpinf1
Ensembl Gene ENSMUSG00000000753
Gene Nameserine (or cysteine) peptidase inhibitor, clade F, member 1
Synonymsalpha-2 antiplasmin, Pedfl, Pedf, pigment epithelium derived factor, EPC-1, Sdf3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R7171 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location75409769-75422701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75417985 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 2 (Q2L)
Ref Sequence ENSEMBL: ENSMUSP00000000769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000769] [ENSMUST00000125982] [ENSMUST00000137103] [ENSMUST00000138661] [ENSMUST00000155009] [ENSMUST00000168902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000769
AA Change: Q2L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000769
Gene: ENSMUSG00000000753
AA Change: Q2L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 414 5.22e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125982
AA Change: Q2L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126807
Gene: ENSMUSG00000000753
AA Change: Q2L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Serpin 55 147 4.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137103
AA Change: Q2L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114761
Gene: ENSMUSG00000000753
AA Change: Q2L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 210 7.93e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138661
AA Change: Q2L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121180
Gene: ENSMUSG00000000753
AA Change: Q2L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 205 1.47e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155009
AA Change: Q2L

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131531
Gene: ENSMUSG00000000753
AA Change: Q2L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1IMV|A 27 64 2e-16 PDB
SCOP:d1imva_ 35 64 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167281
SMART Domains Protein: ENSMUSP00000133230
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
Pfam:Serpin 1 122 7.9e-17 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168902
AA Change: Q2L
SMART Domains Protein: ENSMUSP00000131043
Gene: ENSMUSG00000000753
AA Change: Q2L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family that does not display the serine protease inhibitory activity shown by many of the other serpin proteins. The encoded protein is secreted and strongly inhibits angiogenesis. In addition, this protein is a neurotrophic factor involved in neuronal differentiation in retinoblastoma cells. Mutations in this gene were found in individuals with osteogenesis imperfecta, type VI. [provided by RefSeq, Aug 2016]
PHENOTYPE: Loss of function results in increased microvasculature, pancreatic enlargement, and prostatic hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik T C 2: 154,612,977 N154S unknown Het
9530053A07Rik T A 7: 28,154,519 L1636* probably null Het
Ank3 C T 10: 69,992,481 H2327Y Het
Ano6 A G 15: 95,920,291 Y305C probably damaging Het
Apc2 A G 10: 80,315,336 T2075A possibly damaging Het
Arl6 A G 16: 59,623,092 V93A possibly damaging Het
Bcas3 T C 11: 85,583,937 S790P probably damaging Het
Bcl9l C A 9: 44,505,151 H211N probably benign Het
Bptf G T 11: 107,131,407 D172E unknown Het
Card9 T G 2: 26,359,484 I22L possibly damaging Het
Catsperg1 C A 7: 29,185,212 G933V probably damaging Het
Catsperg2 T A 7: 29,705,325 H771L possibly damaging Het
Ccdc66 T C 14: 27,493,272 N281S possibly damaging Het
Cfap54 A T 10: 92,776,210 L3162H probably damaging Het
Clca4a A G 3: 144,958,173 L503P probably benign Het
Cpn1 T C 19: 43,974,031 N160D probably damaging Het
Ctsh T A 9: 90,067,101 I206K probably benign Het
Cyb561d1 G A 3: 108,199,363 T180M probably damaging Het
Dapk1 A T 13: 60,761,785 D1404V probably damaging Het
Dip2c G T 13: 9,506,648 R76L probably benign Het
Dnah7c T C 1: 46,680,738 I2783T probably damaging Het
E130308A19Rik T C 4: 59,690,333 Y56H probably damaging Het
Efemp2 G T 19: 5,480,257 A310S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faap24 G A 7: 35,392,854 Q213* probably null Het
Fam181b G A 7: 93,080,735 G239S possibly damaging Het
Fancm T C 12: 65,101,620 W670R probably damaging Het
Fmnl1 T C 11: 103,190,398 Y357H probably damaging Het
Fryl A T 5: 73,122,310 V215E probably damaging Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fsip2 T A 2: 82,986,227 Y4101* probably null Het
Gcn1l1 G A 5: 115,590,293 V738I probably benign Het
Gdf9 C T 11: 53,437,539 R441C probably damaging Het
Gipc3 C T 10: 81,341,621 G79E probably damaging Het
Gzmf T A 14: 56,205,934 I196L probably benign Het
Hectd1 A T 12: 51,759,297 V1852E probably damaging Het
Hip1r A T 5: 123,995,944 Q256L probably benign Het
Hmgxb4 T C 8: 75,020,262 S405P probably damaging Het
Il9r T A 11: 32,192,671 H294L probably benign Het
Kif12 G A 4: 63,168,694 T331I probably damaging Het
Krtap8-1 A T 16: 89,487,906 M1K probably null Het
Lamc2 A T 1: 153,139,749 C613S probably damaging Het
Lgr4 T A 2: 110,000,969 N314K probably benign Het
Lpcat2 T C 8: 92,909,266 I432T probably benign Het
Mfhas1 T C 8: 35,588,992 V207A probably benign Het
Msh3 T G 13: 92,349,298 T173P probably benign Het
Mup15 T A 4: 61,438,268 M87L probably benign Het
N4bp2 T C 5: 65,808,022 V1138A probably benign Het
Noc2l T C 4: 156,241,722 V422A probably benign Het
Notch3 C T 17: 32,158,962 G74D probably damaging Het
Ocstamp T A 2: 165,398,161 K35I probably benign Het
Olfr360 T C 2: 37,068,388 F28L possibly damaging Het
Olfr459 T G 6: 41,772,027 T91P probably benign Het
Olfr482 A G 7: 108,095,135 V145A probably benign Het
Olfr692 A G 7: 105,368,761 H145R probably benign Het
Plekhh2 T A 17: 84,521,788 V29D probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Rad54l2 C T 9: 106,713,478 R483H probably damaging Het
Rapgef6 T A 11: 54,676,363 D1128E possibly damaging Het
Rhbdl2 T A 4: 123,814,256 I86N possibly damaging Het
Rims1 C A 1: 22,428,489 R68L Het
Rnf157 A G 11: 116,362,373 F70L possibly damaging Het
Rtp3 C T 9: 110,985,941 C452Y unknown Het
S100a14 A T 3: 90,527,762 K27* probably null Het
Scai C T 2: 39,106,936 G282D possibly damaging Het
Sclt1 A T 3: 41,717,760 I132N probably benign Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc16a10 C G 10: 40,037,259 E484D probably benign Het
Slc1a5 T A 7: 16,797,538 D489E probably damaging Het
Slx4 C T 16: 3,990,786 R430H probably benign Het
Teddm1b A T 1: 153,874,933 I163F probably damaging Het
Tmem171 A T 13: 98,692,236 C135* probably null Het
Tmem82 C T 4: 141,614,973 R306H possibly damaging Het
Tmem94 T A 11: 115,790,955 probably null Het
Trpm2 A C 10: 77,924,014 L1096R probably damaging Het
Trrap T A 5: 144,794,049 L780Q probably damaging Het
Txlnb A G 10: 17,842,984 D521G probably benign Het
Usp7 T C 16: 8,716,526 D59G probably benign Het
Vcan G A 13: 89,725,591 T48I probably damaging Het
Vmn1r45 A G 6: 89,933,334 L218P probably damaging Het
Wdr25 A T 12: 109,024,996 T370S probably damaging Het
Other mutations in Serpinf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
clenched UTSW 11 75413905 critical splice donor site probably null
R0306:Serpinf1 UTSW 11 75413935 missense probably damaging 1.00
R0379:Serpinf1 UTSW 11 75413945 missense probably benign 0.25
R1588:Serpinf1 UTSW 11 75410250 missense probably damaging 0.99
R1720:Serpinf1 UTSW 11 75413981 missense probably null 0.26
R1917:Serpinf1 UTSW 11 75411007 missense possibly damaging 0.72
R1961:Serpinf1 UTSW 11 75416419 missense probably benign 0.01
R4704:Serpinf1 UTSW 11 75411041 missense probably damaging 0.99
R5138:Serpinf1 UTSW 11 75415028 missense probably damaging 1.00
R5618:Serpinf1 UTSW 11 75410184 missense possibly damaging 0.47
R6327:Serpinf1 UTSW 11 75413905 critical splice donor site probably null
R7031:Serpinf1 UTSW 11 75410196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTCTGGATCCTGAAAG -3'
(R):5'- CACAGCTCAAGGAGAAGTGC -3'

Sequencing Primer
(F):5'- GTCTCGATGTTAAAGTAACCAAGGCC -3'
(R):5'- CTCAAGGAGAAGTGCAGGGGC -3'
Posted On2019-06-26