Incidental Mutation 'R7171:Fscn2'
ID558293
Institutional Source Beutler Lab
Gene Symbol Fscn2
Ensembl Gene ENSMUSG00000025380
Gene Namefascin actin-bundling protein 2
SynonymsC630046B20Rik, ahl8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R7171 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120361534-120368168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120362509 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 267 (N267K)
Ref Sequence ENSEMBL: ENSMUSP00000026445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445]
Predicted Effect probably damaging
Transcript: ENSMUST00000026445
AA Change: N267K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380
AA Change: N267K

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal generation with structural abnormalities of the outer segment and depressed rod and cone ERGs that worsen with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik T C 2: 154,612,977 N154S unknown Het
9530053A07Rik T A 7: 28,154,519 L1636* probably null Het
Ank3 C T 10: 69,992,481 H2327Y Het
Ano6 A G 15: 95,920,291 Y305C probably damaging Het
Apc2 A G 10: 80,315,336 T2075A possibly damaging Het
Arl6 A G 16: 59,623,092 V93A possibly damaging Het
Bcas3 T C 11: 85,583,937 S790P probably damaging Het
Bcl9l C A 9: 44,505,151 H211N probably benign Het
Bptf G T 11: 107,131,407 D172E unknown Het
Card9 T G 2: 26,359,484 I22L possibly damaging Het
Catsperg1 C A 7: 29,185,212 G933V probably damaging Het
Catsperg2 T A 7: 29,705,325 H771L possibly damaging Het
Ccdc66 T C 14: 27,493,272 N281S possibly damaging Het
Cfap54 A T 10: 92,776,210 L3162H probably damaging Het
Clca4a A G 3: 144,958,173 L503P probably benign Het
Cpn1 T C 19: 43,974,031 N160D probably damaging Het
Ctsh T A 9: 90,067,101 I206K probably benign Het
Cyb561d1 G A 3: 108,199,363 T180M probably damaging Het
Dapk1 A T 13: 60,761,785 D1404V probably damaging Het
Dip2c G T 13: 9,506,648 R76L probably benign Het
Dnah7c T C 1: 46,680,738 I2783T probably damaging Het
E130308A19Rik T C 4: 59,690,333 Y56H probably damaging Het
Efemp2 G T 19: 5,480,257 A310S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faap24 G A 7: 35,392,854 Q213* probably null Het
Fam181b G A 7: 93,080,735 G239S possibly damaging Het
Fancm T C 12: 65,101,620 W670R probably damaging Het
Fmnl1 T C 11: 103,190,398 Y357H probably damaging Het
Fryl A T 5: 73,122,310 V215E probably damaging Het
Fsip2 T A 2: 82,986,227 Y4101* probably null Het
Gcn1l1 G A 5: 115,590,293 V738I probably benign Het
Gdf9 C T 11: 53,437,539 R441C probably damaging Het
Gipc3 C T 10: 81,341,621 G79E probably damaging Het
Gzmf T A 14: 56,205,934 I196L probably benign Het
Hectd1 A T 12: 51,759,297 V1852E probably damaging Het
Hip1r A T 5: 123,995,944 Q256L probably benign Het
Hmgxb4 T C 8: 75,020,262 S405P probably damaging Het
Il9r T A 11: 32,192,671 H294L probably benign Het
Kif12 G A 4: 63,168,694 T331I probably damaging Het
Krtap8-1 A T 16: 89,487,906 M1K probably null Het
Lamc2 A T 1: 153,139,749 C613S probably damaging Het
Lgr4 T A 2: 110,000,969 N314K probably benign Het
Lpcat2 T C 8: 92,909,266 I432T probably benign Het
Mfhas1 T C 8: 35,588,992 V207A probably benign Het
Msh3 T G 13: 92,349,298 T173P probably benign Het
Mup15 T A 4: 61,438,268 M87L probably benign Het
N4bp2 T C 5: 65,808,022 V1138A probably benign Het
Noc2l T C 4: 156,241,722 V422A probably benign Het
Notch3 C T 17: 32,158,962 G74D probably damaging Het
Ocstamp T A 2: 165,398,161 K35I probably benign Het
Olfr360 T C 2: 37,068,388 F28L possibly damaging Het
Olfr459 T G 6: 41,772,027 T91P probably benign Het
Olfr482 A G 7: 108,095,135 V145A probably benign Het
Olfr692 A G 7: 105,368,761 H145R probably benign Het
Plekhh2 T A 17: 84,521,788 V29D probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Rad54l2 C T 9: 106,713,478 R483H probably damaging Het
Rapgef6 T A 11: 54,676,363 D1128E possibly damaging Het
Rhbdl2 T A 4: 123,814,256 I86N possibly damaging Het
Rims1 C A 1: 22,428,489 R68L Het
Rnf157 A G 11: 116,362,373 F70L possibly damaging Het
Rtp3 C T 9: 110,985,941 C452Y unknown Het
S100a14 A T 3: 90,527,762 K27* probably null Het
Scai C T 2: 39,106,936 G282D possibly damaging Het
Sclt1 A T 3: 41,717,760 I132N probably benign Het
Serpinf1 T A 11: 75,417,985 Q2L possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc16a10 C G 10: 40,037,259 E484D probably benign Het
Slc1a5 T A 7: 16,797,538 D489E probably damaging Het
Slx4 C T 16: 3,990,786 R430H probably benign Het
Teddm1b A T 1: 153,874,933 I163F probably damaging Het
Tmem171 A T 13: 98,692,236 C135* probably null Het
Tmem82 C T 4: 141,614,973 R306H possibly damaging Het
Tmem94 T A 11: 115,790,955 probably null Het
Trpm2 A C 10: 77,924,014 L1096R probably damaging Het
Trrap T A 5: 144,794,049 L780Q probably damaging Het
Txlnb A G 10: 17,842,984 D521G probably benign Het
Usp7 T C 16: 8,716,526 D59G probably benign Het
Vcan G A 13: 89,725,591 T48I probably damaging Het
Vmn1r45 A G 6: 89,933,334 L218P probably damaging Het
Wdr25 A T 12: 109,024,996 T370S probably damaging Het
Other mutations in Fscn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Fscn2 APN 11 120367305 missense probably damaging 0.99
IGL01767:Fscn2 APN 11 120367750 missense possibly damaging 0.82
IGL02212:Fscn2 APN 11 120362055 missense probably damaging 1.00
IGL02299:Fscn2 APN 11 120362199 missense probably benign 0.09
IGL02494:Fscn2 APN 11 120362402 missense probably benign 0.02
IGL02716:Fscn2 APN 11 120366724 missense probably benign 0.00
IGL02882:Fscn2 APN 11 120362499 missense probably benign
IGL02986:Fscn2 APN 11 120367350 missense possibly damaging 0.74
ANU74:Fscn2 UTSW 11 120362336 missense probably damaging 1.00
R0277:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0323:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0513:Fscn2 UTSW 11 120361880 missense probably damaging 1.00
R1451:Fscn2 UTSW 11 120362022 missense probably damaging 0.98
R1620:Fscn2 UTSW 11 120366685 missense probably damaging 1.00
R1736:Fscn2 UTSW 11 120368026 missense probably damaging 1.00
R2212:Fscn2 UTSW 11 120361591 start gained probably benign
R2327:Fscn2 UTSW 11 120366701 missense probably damaging 1.00
R2384:Fscn2 UTSW 11 120366733 missense possibly damaging 0.48
R2397:Fscn2 UTSW 11 120362169 missense probably damaging 1.00
R4624:Fscn2 UTSW 11 120367343 missense probably benign 0.21
R4634:Fscn2 UTSW 11 120367720 missense possibly damaging 0.65
R4784:Fscn2 UTSW 11 120367987 missense possibly damaging 0.82
R5062:Fscn2 UTSW 11 120366749 missense probably damaging 1.00
R5084:Fscn2 UTSW 11 120361860 missense probably damaging 0.96
R5514:Fscn2 UTSW 11 120368032 missense probably damaging 1.00
R5780:Fscn2 UTSW 11 120366668 missense probably benign 0.14
R6073:Fscn2 UTSW 11 120361787 nonsense probably null
R6345:Fscn2 UTSW 11 120362027 missense probably damaging 0.99
R7110:Fscn2 UTSW 11 120366754 missense probably benign 0.19
R7170:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACACGCTGGAGTTCAAGGC -3'
(R):5'- AATCTTCGAGGCAGCTGCAG -3'

Sequencing Primer
(F):5'- TTCAAGGCAGGCAAGCTG -3'
(R):5'- GTCTAGCAGGCACCACATTTG -3'
Posted On2019-06-26