Incidental Mutation 'R7171:Efemp2'
ID558313
Institutional Source Beutler Lab
Gene Symbol Efemp2
Ensembl Gene ENSMUSG00000024909
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 2
SynonymsMBP1, fibulin-4, Fbln4, 0610011K11Rik, fibulin 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7171 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5473973-5481853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5480257 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 310 (A310S)
Ref Sequence ENSEMBL: ENSMUSP00000064719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000070118] [ENSMUST00000124334] [ENSMUST00000165485] [ENSMUST00000166253] [ENSMUST00000166303] [ENSMUST00000167304] [ENSMUST00000167371] [ENSMUST00000167827] [ENSMUST00000167855] [ENSMUST00000168330] [ENSMUST00000169943]
Predicted Effect probably benign
Transcript: ENSMUST00000025841
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070118
AA Change: A310S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909
AA Change: A310S

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124334
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133436
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164204
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000131979
Gene: ENSMUSG00000024909
AA Change: A43S

DomainStartEndE-ValueType
EGF 4 35 1.59e1 SMART
EGF 39 81 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165485
AA Change: A291S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909
AA Change: A291S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166253
AA Change: A181S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127312
Gene: ENSMUSG00000024909
AA Change: A181S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 54 92 1.94e-12 SMART
EGF_CA 93 132 1.36e-7 SMART
EGF_CA 133 172 2.19e-11 SMART
EGF 176 218 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166303
SMART Domains Protein: ENSMUSP00000128827
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167304
SMART Domains Protein: ENSMUSP00000129982
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EGF_CA 54 86 2.4e-9 PFAM
low complexity region 96 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167371
AA Change: A250S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909
AA Change: A250S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167827
SMART Domains Protein: ENSMUSP00000127478
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Blast:EGF_like 1 26 9e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
EGF_CA 135 174 1.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167855
SMART Domains Protein: ENSMUSP00000132194
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Blast:EGF_like 1 26 4e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
Predicted Effect silent
Transcript: ENSMUST00000168330
Predicted Effect probably benign
Transcript: ENSMUST00000169943
SMART Domains Protein: ENSMUSP00000126477
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large number of extracellular matrix proteins have been found to contain variations of the epidermal growth factor (EGF) domain and have been implicated in functions as diverse as blood coagulation, activation of complement and determination of cell fate during development. The protein encoded by this gene contains four EGF2 domains and six calcium-binding EGF2 domains. This gene is necessary for elastic fiber formation and connective tissue development. Defects in this gene are cause of an autosomal recessive cutis laxa syndrome. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality with abnormal artery and lung morphology and defects in vascular, pulmonary, and hypodermal elastic fibers. Some alleles of Mus81 also affect expression of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik T C 2: 154,612,977 N154S unknown Het
9530053A07Rik T A 7: 28,154,519 L1636* probably null Het
Ank3 C T 10: 69,992,481 H2327Y Het
Ano6 A G 15: 95,920,291 Y305C probably damaging Het
Apc2 A G 10: 80,315,336 T2075A possibly damaging Het
Arl6 A G 16: 59,623,092 V93A possibly damaging Het
Bcas3 T C 11: 85,583,937 S790P probably damaging Het
Bcl9l C A 9: 44,505,151 H211N probably benign Het
Bptf G T 11: 107,131,407 D172E unknown Het
Card9 T G 2: 26,359,484 I22L possibly damaging Het
Catsperg1 C A 7: 29,185,212 G933V probably damaging Het
Catsperg2 T A 7: 29,705,325 H771L possibly damaging Het
Ccdc66 T C 14: 27,493,272 N281S possibly damaging Het
Cfap54 A T 10: 92,776,210 L3162H probably damaging Het
Clca4a A G 3: 144,958,173 L503P probably benign Het
Cpn1 T C 19: 43,974,031 N160D probably damaging Het
Ctsh T A 9: 90,067,101 I206K probably benign Het
Cyb561d1 G A 3: 108,199,363 T180M probably damaging Het
Dapk1 A T 13: 60,761,785 D1404V probably damaging Het
Dip2c G T 13: 9,506,648 R76L probably benign Het
Dnah7c T C 1: 46,680,738 I2783T probably damaging Het
E130308A19Rik T C 4: 59,690,333 Y56H probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Faap24 G A 7: 35,392,854 Q213* probably null Het
Fam181b G A 7: 93,080,735 G239S possibly damaging Het
Fancm T C 12: 65,101,620 W670R probably damaging Het
Fmnl1 T C 11: 103,190,398 Y357H probably damaging Het
Fryl A T 5: 73,122,310 V215E probably damaging Het
Fscn2 C A 11: 120,362,509 N267K probably damaging Het
Fsip2 T A 2: 82,986,227 Y4101* probably null Het
Gcn1l1 G A 5: 115,590,293 V738I probably benign Het
Gdf9 C T 11: 53,437,539 R441C probably damaging Het
Gipc3 C T 10: 81,341,621 G79E probably damaging Het
Gzmf T A 14: 56,205,934 I196L probably benign Het
Hectd1 A T 12: 51,759,297 V1852E probably damaging Het
Hip1r A T 5: 123,995,944 Q256L probably benign Het
Hmgxb4 T C 8: 75,020,262 S405P probably damaging Het
Il9r T A 11: 32,192,671 H294L probably benign Het
Kif12 G A 4: 63,168,694 T331I probably damaging Het
Krtap8-1 A T 16: 89,487,906 M1K probably null Het
Lamc2 A T 1: 153,139,749 C613S probably damaging Het
Lgr4 T A 2: 110,000,969 N314K probably benign Het
Lpcat2 T C 8: 92,909,266 I432T probably benign Het
Mfhas1 T C 8: 35,588,992 V207A probably benign Het
Msh3 T G 13: 92,349,298 T173P probably benign Het
Mup15 T A 4: 61,438,268 M87L probably benign Het
N4bp2 T C 5: 65,808,022 V1138A probably benign Het
Noc2l T C 4: 156,241,722 V422A probably benign Het
Notch3 C T 17: 32,158,962 G74D probably damaging Het
Ocstamp T A 2: 165,398,161 K35I probably benign Het
Olfr360 T C 2: 37,068,388 F28L possibly damaging Het
Olfr459 T G 6: 41,772,027 T91P probably benign Het
Olfr482 A G 7: 108,095,135 V145A probably benign Het
Olfr692 A G 7: 105,368,761 H145R probably benign Het
Plekhh2 T A 17: 84,521,788 V29D probably damaging Het
Pof1b A G X: 112,644,345 I544T probably benign Het
Rad54l2 C T 9: 106,713,478 R483H probably damaging Het
Rapgef6 T A 11: 54,676,363 D1128E possibly damaging Het
Rhbdl2 T A 4: 123,814,256 I86N possibly damaging Het
Rims1 C A 1: 22,428,489 R68L Het
Rnf157 A G 11: 116,362,373 F70L possibly damaging Het
Rtp3 C T 9: 110,985,941 C452Y unknown Het
S100a14 A T 3: 90,527,762 K27* probably null Het
Scai C T 2: 39,106,936 G282D possibly damaging Het
Sclt1 A T 3: 41,717,760 I132N probably benign Het
Serpinf1 T A 11: 75,417,985 Q2L possibly damaging Het
Skor2 T A 18: 76,860,986 V801E probably benign Het
Slc16a10 C G 10: 40,037,259 E484D probably benign Het
Slc1a5 T A 7: 16,797,538 D489E probably damaging Het
Slx4 C T 16: 3,990,786 R430H probably benign Het
Teddm1b A T 1: 153,874,933 I163F probably damaging Het
Tmem171 A T 13: 98,692,236 C135* probably null Het
Tmem82 C T 4: 141,614,973 R306H possibly damaging Het
Tmem94 T A 11: 115,790,955 probably null Het
Trpm2 A C 10: 77,924,014 L1096R probably damaging Het
Trrap T A 5: 144,794,049 L780Q probably damaging Het
Txlnb A G 10: 17,842,984 D521G probably benign Het
Usp7 T C 16: 8,716,526 D59G probably benign Het
Vcan G A 13: 89,725,591 T48I probably damaging Het
Vmn1r45 A G 6: 89,933,334 L218P probably damaging Het
Wdr25 A T 12: 109,024,996 T370S probably damaging Het
Other mutations in Efemp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03011:Efemp2 APN 19 5480065 missense probably damaging 0.99
IGL03079:Efemp2 APN 19 5475127 missense probably damaging 1.00
H8562:Efemp2 UTSW 19 5480649 missense probably benign 0.43
R0149:Efemp2 UTSW 19 5477960 missense probably damaging 1.00
R0266:Efemp2 UTSW 19 5477999 missense probably damaging 1.00
R0594:Efemp2 UTSW 19 5475063 unclassified probably benign
R0723:Efemp2 UTSW 19 5480050 missense probably damaging 1.00
R2110:Efemp2 UTSW 19 5475162 missense probably damaging 1.00
R4307:Efemp2 UTSW 19 5481621 missense possibly damaging 0.82
R4494:Efemp2 UTSW 19 5480311 missense probably damaging 1.00
R4878:Efemp2 UTSW 19 5480761 unclassified probably benign
R4889:Efemp2 UTSW 19 5475120 missense probably null 1.00
R5156:Efemp2 UTSW 19 5477678 missense possibly damaging 0.93
R5165:Efemp2 UTSW 19 5475411 missense probably damaging 1.00
R6932:Efemp2 UTSW 19 5480245 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATATCGATGAGTGCGGCTAC -3'
(R):5'- CGATTAAACCAGTAGGCCCC -3'

Sequencing Primer
(F):5'- ATGAGTGCGGCTACTCCAGTTAC -3'
(R):5'- GTAGGCCCCACAGACCTC -3'
Posted On2019-06-26