Incidental Mutation 'R7172:Abcb9'
ID558339
Institutional Source Beutler Lab
Gene Symbol Abcb9
Ensembl Gene ENSMUSG00000029408
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 9
SynonymsTAPL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7172 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124061530-124095798 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 124062806 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 716 (Q716*)
Ref Sequence ENSEMBL: ENSMUSP00000031354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031354]
Predicted Effect probably null
Transcript: ENSMUST00000031354
AA Change: Q716*
SMART Domains Protein: ENSMUSP00000031354
Gene: ENSMUSG00000029408
AA Change: Q716*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 184 453 1.9e-61 PFAM
AAA 527 713 4.07e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, it may be associated with lysosome activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 A T 2: 122,638,318 Y33F probably damaging Het
Abca4 C T 3: 122,103,540 Q623* probably null Het
Abcb1a A T 5: 8,702,399 I457F probably benign Het
Abhd15 T C 11: 77,515,296 V33A probably benign Het
Abl2 A G 1: 156,622,587 D108G probably damaging Het
Adamts3 G A 5: 89,883,001 probably benign Het
Atmin G T 8: 116,956,542 V314L probably damaging Het
Axl G T 7: 25,786,974 Q102K probably benign Het
B020004J07Rik A G 4: 101,836,996 V230A probably benign Het
Cdhr5 A G 7: 141,271,928 S488P possibly damaging Het
Cnn1 C A 9: 22,105,494 A126D probably damaging Het
Col25a1 A T 3: 130,570,332 K537* probably null Het
Cxcl2 A G 5: 90,904,020 T26A probably benign Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhx36 T C 3: 62,501,015 D134G probably benign Het
Dnah17 T A 11: 118,041,131 K3672* probably null Het
Fadd G T 7: 144,582,171 H73Q probably benign Het
Fam35a G A 14: 34,237,568 T819I probably damaging Het
Fancm A G 12: 65,106,054 N1095D possibly damaging Het
Fhod3 T C 18: 25,085,546 S789P probably damaging Het
Glis2 G A 16: 4,613,475 V289I probably benign Het
Gm17728 A C 17: 9,422,388 D110A probably damaging Het
Gm9602 T A 14: 4,777,282 S45T possibly damaging Het
Gpr137 A G 19: 6,939,681 S161P possibly damaging Het
Gpr89 C T 3: 96,880,069 probably null Het
Gps2 C T 11: 69,916,436 T306I probably benign Het
Hmcn1 A G 1: 150,753,699 Y936H possibly damaging Het
Hoxa5 A G 6: 52,204,296 Y19H probably damaging Het
Ifit2 G T 19: 34,573,494 A145S probably benign Het
Impdh2 G T 9: 108,560,610 C26F probably benign Het
Kcnh6 T C 11: 106,020,274 Y552H possibly damaging Het
Kcnma1 A T 14: 23,526,623 M254K probably damaging Het
Klhdc9 A T 1: 171,360,660 M1K probably null Het
Klk1b11 A T 7: 43,999,247 D194V possibly damaging Het
Lama1 A G 17: 67,804,545 I2264V Het
Lmntd2 A G 7: 141,213,641 S111P unknown Het
Megf8 T C 7: 25,343,667 L1338P probably damaging Het
Mipol1 G A 12: 57,325,535 E127K possibly damaging Het
Mmp25 A T 17: 23,644,788 C23S probably benign Het
Mup8 A T 4: 60,222,425 C15* probably null Het
Myh2 A T 11: 67,188,701 T995S probably benign Het
Myo1d C T 11: 80,592,795 V863I probably benign Het
N4bp1 A G 8: 86,860,424 probably null Het
Nat10 G T 2: 103,732,969 P562T probably damaging Het
Nedd9 C G 13: 41,316,804 R291P probably benign Het
Nlrc3 G T 16: 3,963,753 H613Q probably benign Het
Ntn1 A T 11: 68,385,667 C152S probably damaging Het
Olfr332 T A 11: 58,489,745 I337F unknown Het
Pam A T 1: 97,834,478 D793E probably benign Het
Patz1 T G 11: 3,308,032 V631G probably benign Het
Pcdh15 G A 10: 74,502,765 V1068M probably damaging Het
Prmt5 A G 14: 54,514,886 F151S possibly damaging Het
Pygo2 G A 3: 89,432,636 V114I probably benign Het
Rabgap1l A T 1: 160,733,586 S220R probably benign Het
Rdh7 T G 10: 127,888,349 S89R possibly damaging Het
Rgsl1 A C 1: 153,826,220 W163G possibly damaging Het
Ryr3 T A 2: 112,661,657 N3783I probably damaging Het
Slit1 A G 19: 41,634,666 L644P probably damaging Het
Steap2 A G 5: 5,682,896 S43P possibly damaging Het
Susd1 A T 4: 59,315,420 probably null Het
Tbc1d9 A G 8: 83,254,761 M686V probably damaging Het
Tdrp G A 8: 13,974,579 R22* probably null Het
Tmem245 A G 4: 56,903,946 V598A possibly damaging Het
Tnxb A G 17: 34,696,020 E1994G probably damaging Het
Trcg1 T A 9: 57,248,335 V757E probably benign Het
Trim10 A G 17: 36,870,063 E62G possibly damaging Het
Ushbp1 G T 8: 71,388,766 A473E possibly damaging Het
Vmn1r50 A C 6: 90,107,404 K44Q possibly damaging Het
Wdr75 A G 1: 45,799,134 N68D probably damaging Het
Wdr83 A G 8: 85,079,824 V115A probably damaging Het
Zdhhc17 A G 10: 111,009,948 L28P possibly damaging Het
Zfp738 C T 13: 67,670,408 C488Y probably damaging Het
Zfp987 T G 4: 146,122,002 L50W probably damaging Het
Zfyve28 G T 5: 34,234,409 R133S probably benign Het
Zscan20 G T 4: 128,585,676 C1007* probably null Het
Other mutations in Abcb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Abcb9 APN 5 124077238 missense possibly damaging 0.90
R0045:Abcb9 UTSW 5 124082085 missense probably damaging 0.96
R0106:Abcb9 UTSW 5 124083060 missense possibly damaging 0.70
R0153:Abcb9 UTSW 5 124080056 missense probably benign 0.00
R0194:Abcb9 UTSW 5 124077295 missense probably damaging 0.99
R0458:Abcb9 UTSW 5 124082146 critical splice acceptor site probably null
R0669:Abcb9 UTSW 5 124062887 missense probably damaging 0.97
R1240:Abcb9 UTSW 5 124089921 missense probably benign 0.02
R1480:Abcb9 UTSW 5 124078826 missense probably benign 0.00
R1544:Abcb9 UTSW 5 124083631 missense probably benign
R1878:Abcb9 UTSW 5 124090136 missense probably benign 0.02
R2355:Abcb9 UTSW 5 124077305 frame shift probably null
R2358:Abcb9 UTSW 5 124077305 frame shift probably null
R2520:Abcb9 UTSW 5 124080028 splice site probably null
R2926:Abcb9 UTSW 5 124078839 missense possibly damaging 0.84
R3795:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R3911:Abcb9 UTSW 5 124089846 missense probably benign 0.06
R4679:Abcb9 UTSW 5 124078804 missense probably benign 0.20
R4789:Abcb9 UTSW 5 124078790 missense probably benign 0.00
R4821:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R5116:Abcb9 UTSW 5 124078867 missense probably damaging 1.00
R5804:Abcb9 UTSW 5 124080055 missense probably benign
R5997:Abcb9 UTSW 5 124089815 missense possibly damaging 0.85
R6197:Abcb9 UTSW 5 124071749 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGCTGCTCTACCTTGGC -3'
(R):5'- TCAGGACTTGAGCTGCCTTG -3'

Sequencing Primer
(F):5'- TCTACCTTGGCAGGCCTG -3'
(R):5'- TGAATGTCAGCTGGCAGC -3'
Posted On2019-06-26