Incidental Mutation 'R7172:Kcnma1'
ID558374
Institutional Source Beutler Lab
Gene Symbol Kcnma1
Ensembl Gene ENSMUSG00000063142
Gene Namepotassium large conductance calcium-activated channel, subfamily M, alpha member 1
SynonymsmSlo1, MaxiK, Slo1, 5730414M22Rik, BK channel alpha subunit, BKCa, Slo
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R7172 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location23289431-24014491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23526623 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 254 (M254K)
Ref Sequence ENSEMBL: ENSMUSP00000128553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065788] [ENSMUST00000074983] [ENSMUST00000100831] [ENSMUST00000112423] [ENSMUST00000145596] [ENSMUST00000163322] [ENSMUST00000172099] [ENSMUST00000177634] [ENSMUST00000179097] [ENSMUST00000179836] [ENSMUST00000188210] [ENSMUST00000188285] [ENSMUST00000188991] [ENSMUST00000190044] [ENSMUST00000190985] [ENSMUST00000212576] [ENSMUST00000223655] [ENSMUST00000223727] [ENSMUST00000223749] [ENSMUST00000224077] [ENSMUST00000224232] [ENSMUST00000224285] [ENSMUST00000224468] [ENSMUST00000224787] [ENSMUST00000224812] [ENSMUST00000225315] [ENSMUST00000225431] [ENSMUST00000225471] [ENSMUST00000225556] [ENSMUST00000225794] [ENSMUST00000226051]
Predicted Effect probably benign
Transcript: ENSMUST00000065788
SMART Domains Protein: ENSMUSP00000065293
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 835 843 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 1005 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074983
SMART Domains Protein: ENSMUSP00000074511
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.5e-7 PFAM
Pfam:BK_channel_a 411 509 6.4e-31 PFAM
low complexity region 894 902 N/A INTRINSIC
low complexity region 950 961 N/A INTRINSIC
low complexity region 1064 1090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100831
SMART Domains Protein: ENSMUSP00000098393
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.1e-18 PFAM
Pfam:Ion_trans_2 180 268 5.5e-16 PFAM
Pfam:TrkA_N 314 413 7.3e-7 PFAM
Pfam:BK_channel_a 411 509 6.2e-31 PFAM
low complexity region 865 873 N/A INTRINSIC
low complexity region 921 932 N/A INTRINSIC
low complexity region 1035 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112423
SMART Domains Protein: ENSMUSP00000108042
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:Ion_trans 37 208 2.1e-18 PFAM
Pfam:Ion_trans_2 126 214 5.3e-16 PFAM
Pfam:TrkA_N 260 359 7e-7 PFAM
Pfam:BK_channel_a 357 455 6e-31 PFAM
low complexity region 781 789 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 951 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145596
Predicted Effect probably damaging
Transcript: ENSMUST00000163322
AA Change: M254K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128553
Gene: ENSMUSG00000063142
AA Change: M254K

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 3.2e-18 PFAM
Pfam:Ion_trans_2 180 268 1.1e-15 PFAM
Pfam:TrkA_N 314 413 7e-7 PFAM
Pfam:BK_channel_a 411 509 6e-31 PFAM
low complexity region 832 840 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 1002 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172099
SMART Domains Protein: ENSMUSP00000132204
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 2.2e-18 PFAM
Pfam:Ion_trans_2 180 268 5.7e-16 PFAM
Pfam:TrkA_N 314 413 7.6e-7 PFAM
Pfam:BK_channel_a 411 509 6.5e-31 PFAM
low complexity region 897 905 N/A INTRINSIC
low complexity region 953 964 N/A INTRINSIC
low complexity region 1067 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177634
SMART Domains Protein: ENSMUSP00000136447
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
Pfam:Ion_trans 53 272 4.9e-19 PFAM
Pfam:Ion_trans_2 180 267 1.2e-15 PFAM
Pfam:BK_channel_a 413 508 1.2e-35 PFAM
low complexity region 862 870 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1032 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179097
SMART Domains Protein: ENSMUSP00000136568
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.6e-18 PFAM
Pfam:Ion_trans_2 180 268 1e-15 PFAM
Pfam:TrkA_N 314 413 1.1e-7 PFAM
Pfam:BK_channel_a 411 509 3.2e-31 PFAM
low complexity region 859 867 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1029 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179836
SMART Domains Protein: ENSMUSP00000137141
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
Pfam:Ion_trans 91 262 4.2e-18 PFAM
Pfam:Ion_trans_2 180 268 9.5e-16 PFAM
Pfam:BK_channel_a 389 457 2.4e-15 PFAM
low complexity region 838 846 N/A INTRINSIC
low complexity region 894 905 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188210
SMART Domains Protein: ENSMUSP00000141069
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.2e-16 PFAM
Pfam:TrkA_N 439 538 7.8e-7 PFAM
Pfam:BK_channel_a 536 634 5e-31 PFAM
low complexity region 988 996 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
low complexity region 1158 1184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188285
SMART Domains Protein: ENSMUSP00000140275
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.4e-16 PFAM
Pfam:TrkA_N 439 538 8e-7 PFAM
Pfam:BK_channel_a 536 634 5.2e-31 PFAM
low complexity region 1019 1027 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1189 1215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188991
SMART Domains Protein: ENSMUSP00000140751
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 3.3e-18 PFAM
Pfam:Ion_trans_2 305 393 1.1e-15 PFAM
Pfam:TrkA_N 439 538 3.7e-7 PFAM
Pfam:BK_channel_a 536 634 3.4e-31 PFAM
low complexity region 1015 1023 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1185 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190044
SMART Domains Protein: ENSMUSP00000140033
Gene: ENSMUSG00000063142

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
Pfam:Ion_trans 216 387 1.3e-18 PFAM
Pfam:Ion_trans_2 305 393 5.1e-16 PFAM
Pfam:TrkA_N 439 538 7.5e-7 PFAM
Pfam:BK_channel_a 536 634 4.9e-31 PFAM
low complexity region 957 965 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1127 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190985
Predicted Effect probably benign
Transcript: ENSMUST00000212576
Predicted Effect probably benign
Transcript: ENSMUST00000223655
Predicted Effect probably benign
Transcript: ENSMUST00000223727
Predicted Effect probably benign
Transcript: ENSMUST00000223749
Predicted Effect probably benign
Transcript: ENSMUST00000224025
Predicted Effect probably benign
Transcript: ENSMUST00000224077
Predicted Effect probably benign
Transcript: ENSMUST00000224232
Predicted Effect probably damaging
Transcript: ENSMUST00000224285
AA Change: M314K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000224468
Predicted Effect probably benign
Transcript: ENSMUST00000224787
Predicted Effect probably benign
Transcript: ENSMUST00000224812
Predicted Effect probably benign
Transcript: ENSMUST00000225315
Predicted Effect probably benign
Transcript: ENSMUST00000225431
Predicted Effect probably benign
Transcript: ENSMUST00000225471
Predicted Effect probably benign
Transcript: ENSMUST00000225556
Predicted Effect probably benign
Transcript: ENSMUST00000225794
AA Change: C345S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226051
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to cerebellar ataxia, Purkinje cell dysfunction, uneven gait patterns, bladder hyperactivity, urinary incontinence, abnormal colonic K+ secretion, and hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 A T 2: 122,638,318 Y33F probably damaging Het
Abca4 C T 3: 122,103,540 Q623* probably null Het
Abcb1a A T 5: 8,702,399 I457F probably benign Het
Abcb9 G A 5: 124,062,806 Q716* probably null Het
Abhd15 T C 11: 77,515,296 V33A probably benign Het
Abl2 A G 1: 156,622,587 D108G probably damaging Het
Adamts3 G A 5: 89,883,001 probably benign Het
Atmin G T 8: 116,956,542 V314L probably damaging Het
Axl G T 7: 25,786,974 Q102K probably benign Het
B020004J07Rik A G 4: 101,836,996 V230A probably benign Het
Cdhr5 A G 7: 141,271,928 S488P possibly damaging Het
Cnn1 C A 9: 22,105,494 A126D probably damaging Het
Cxcl2 A G 5: 90,904,020 T26A probably benign Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhx36 T C 3: 62,501,015 D134G probably benign Het
Dnah17 T A 11: 118,041,131 K3672* probably null Het
Fadd G T 7: 144,582,171 H73Q probably benign Het
Fam35a G A 14: 34,237,568 T819I probably damaging Het
Fancm A G 12: 65,106,054 N1095D possibly damaging Het
Fhod3 T C 18: 25,085,546 S789P probably damaging Het
Glis2 G A 16: 4,613,475 V289I probably benign Het
Gm17728 A C 17: 9,422,388 D110A probably damaging Het
Gm9602 T A 14: 4,777,282 S45T possibly damaging Het
Gpr137 A G 19: 6,939,681 S161P possibly damaging Het
Gps2 C T 11: 69,916,436 T306I probably benign Het
Hmcn1 A G 1: 150,753,699 Y936H possibly damaging Het
Hoxa5 A G 6: 52,204,296 Y19H probably damaging Het
Ifit2 G T 19: 34,573,494 A145S probably benign Het
Impdh2 G T 9: 108,560,610 C26F probably benign Het
Kcnh6 T C 11: 106,020,274 Y552H possibly damaging Het
Klhdc9 A T 1: 171,360,660 M1K probably null Het
Klk1b11 A T 7: 43,999,247 D194V possibly damaging Het
Lama1 A G 17: 67,804,545 I2264V Het
Lmntd2 A G 7: 141,213,641 S111P unknown Het
Megf8 T C 7: 25,343,667 L1338P probably damaging Het
Mipol1 G A 12: 57,325,535 E127K possibly damaging Het
Mmp25 A T 17: 23,644,788 C23S probably benign Het
Mup8 A T 4: 60,222,425 C15* probably null Het
Myh2 A T 11: 67,188,701 T995S probably benign Het
Myo1d C T 11: 80,592,795 V863I probably benign Het
N4bp1 A G 8: 86,860,424 probably null Het
Nat10 G T 2: 103,732,969 P562T probably damaging Het
Nedd9 C G 13: 41,316,804 R291P probably benign Het
Nlrc3 G T 16: 3,963,753 H613Q probably benign Het
Ntn1 A T 11: 68,385,667 C152S probably damaging Het
Olfr332 T A 11: 58,489,745 I337F unknown Het
Pam A T 1: 97,834,478 D793E probably benign Het
Patz1 T G 11: 3,308,032 V631G probably benign Het
Pcdh15 G A 10: 74,502,765 V1068M probably damaging Het
Prmt5 A G 14: 54,514,886 F151S possibly damaging Het
Pygo2 G A 3: 89,432,636 V114I probably benign Het
Rabgap1l A T 1: 160,733,586 S220R probably benign Het
Rdh7 T G 10: 127,888,349 S89R possibly damaging Het
Rgsl1 A C 1: 153,826,220 W163G possibly damaging Het
Ryr3 T A 2: 112,661,657 N3783I probably damaging Het
Slit1 A G 19: 41,634,666 L644P probably damaging Het
Steap2 A G 5: 5,682,896 S43P possibly damaging Het
Tbc1d9 A G 8: 83,254,761 M686V probably damaging Het
Tdrp G A 8: 13,974,579 R22* probably null Het
Tmem245 A G 4: 56,903,946 V598A possibly damaging Het
Tnxb A G 17: 34,696,020 E1994G probably damaging Het
Trcg1 T A 9: 57,248,335 V757E probably benign Het
Trim10 A G 17: 36,870,063 E62G possibly damaging Het
Ushbp1 G T 8: 71,388,766 A473E possibly damaging Het
Vmn1r50 A C 6: 90,107,404 K44Q possibly damaging Het
Wdr75 A G 1: 45,799,134 N68D probably damaging Het
Wdr83 A G 8: 85,079,824 V115A probably damaging Het
Zdhhc17 A G 10: 111,009,948 L28P possibly damaging Het
Zfp738 C T 13: 67,670,408 C488Y probably damaging Het
Zfp987 T G 4: 146,122,002 L50W probably damaging Het
Zfyve28 G T 5: 34,234,409 R133S probably benign Het
Zscan20 G T 4: 128,585,676 C1007* probably null Het
Other mutations in Kcnma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kcnma1 APN 14 23314322 splice site probably benign
IGL01520:Kcnma1 APN 14 23501143 missense possibly damaging 0.94
IGL01977:Kcnma1 APN 14 23530299 splice site probably benign
IGL02140:Kcnma1 APN 14 23309045 missense probably damaging 1.00
IGL02165:Kcnma1 APN 14 23336967 missense possibly damaging 0.93
IGL02186:Kcnma1 APN 14 23526813 missense probably benign 0.28
IGL02268:Kcnma1 APN 14 23543076 missense probably damaging 1.00
IGL02353:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02360:Kcnma1 APN 14 23591613 missense probably damaging 1.00
IGL02491:Kcnma1 APN 14 23311689 missense probably damaging 1.00
IGL02552:Kcnma1 APN 14 23386259 critical splice donor site probably null
IGL02625:Kcnma1 APN 14 23363832 missense probably damaging 1.00
IGL02677:Kcnma1 APN 14 23463156 missense probably damaging 1.00
IGL02706:Kcnma1 APN 14 23309154 missense probably damaging 1.00
PIT4495001:Kcnma1 UTSW 14 23425597 missense probably benign 0.00
PIT4514001:Kcnma1 UTSW 14 23309035 splice site probably null
PIT4576001:Kcnma1 UTSW 14 23309035 splice site probably null
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0071:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0115:Kcnma1 UTSW 14 23314175 missense probably damaging 1.00
R0172:Kcnma1 UTSW 14 23803166 missense probably damaging 1.00
R0178:Kcnma1 UTSW 14 23526767 missense probably damaging 1.00
R0183:Kcnma1 UTSW 14 23508052 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0240:Kcnma1 UTSW 14 23494579 missense probably damaging 1.00
R0328:Kcnma1 UTSW 14 23373197 missense probably damaging 1.00
R0501:Kcnma1 UTSW 14 23311716 missense possibly damaging 0.80
R0631:Kcnma1 UTSW 14 23509784 splice site probably benign
R0668:Kcnma1 UTSW 14 23367495 missense probably damaging 1.00
R0811:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R0812:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R1080:Kcnma1 UTSW 14 23494607 missense probably damaging 1.00
R1419:Kcnma1 UTSW 14 23367642 missense probably damaging 0.99
R1446:Kcnma1 UTSW 14 23311724 missense probably damaging 1.00
R1454:Kcnma1 UTSW 14 23463200 missense probably damaging 1.00
R1651:Kcnma1 UTSW 14 23314194 missense probably damaging 1.00
R1826:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1827:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1828:Kcnma1 UTSW 14 23330929 missense probably damaging 1.00
R1864:Kcnma1 UTSW 14 23803162 missense probably damaging 1.00
R2002:Kcnma1 UTSW 14 23337029 missense probably damaging 0.99
R2140:Kcnma1 UTSW 14 23314220 missense probably damaging 1.00
R2278:Kcnma1 UTSW 14 23543083 nonsense probably null
R2866:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2867:Kcnma1 UTSW 14 23373207 missense probably benign 0.16
R2900:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R3820:Kcnma1 UTSW 14 23299938 missense possibly damaging 0.66
R3821:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R3901:Kcnma1 UTSW 14 23505255 missense probably damaging 0.98
R3975:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R3976:Kcnma1 UTSW 14 24003747 critical splice donor site probably null
R4352:Kcnma1 UTSW 14 23311652 missense probably damaging 1.00
R4517:Kcnma1 UTSW 14 23337029 missense probably damaging 1.00
R4598:Kcnma1 UTSW 14 23803160 missense probably damaging 1.00
R4604:Kcnma1 UTSW 14 23309038 critical splice donor site probably null
R4743:Kcnma1 UTSW 14 23803202 missense probably damaging 1.00
R4754:Kcnma1 UTSW 14 23363836 missense probably damaging 0.96
R4908:Kcnma1 UTSW 14 23309152 missense probably damaging 0.99
R4960:Kcnma1 UTSW 14 24004118 intron probably benign
R5175:Kcnma1 UTSW 14 23336038 critical splice donor site probably null
R5218:Kcnma1 UTSW 14 23463185 missense probably damaging 0.96
R5435:Kcnma1 UTSW 14 23528404 nonsense probably null
R5705:Kcnma1 UTSW 14 24003771 missense possibly damaging 0.73
R5746:Kcnma1 UTSW 14 23494567 missense probably damaging 1.00
R5780:Kcnma1 UTSW 14 23386351 nonsense probably null
R5793:Kcnma1 UTSW 14 23309035 splice site probably null
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6039:Kcnma1 UTSW 14 23309037 missense probably benign 0.42
R6133:Kcnma1 UTSW 14 24003868 missense probably damaging 0.98
R6271:Kcnma1 UTSW 14 23509889 missense probably damaging 1.00
R6490:Kcnma1 UTSW 14 23336097 missense possibly damaging 0.46
R6704:Kcnma1 UTSW 14 24002814 nonsense probably null
R6822:Kcnma1 UTSW 14 24003744 splice site probably null
R6855:Kcnma1 UTSW 14 23367611 missense probably damaging 1.00
R6920:Kcnma1 UTSW 14 23526534 critical splice donor site probably null
R7017:Kcnma1 UTSW 14 23494643 missense possibly damaging 0.79
R7081:Kcnma1 UTSW 14 23300018 missense probably damaging 0.96
R7113:Kcnma1 UTSW 14 23463156 missense probably damaging 1.00
R7131:Kcnma1 UTSW 14 23367494 missense probably damaging 1.00
R7207:Kcnma1 UTSW 14 23309015 makesense probably null
R7308:Kcnma1 UTSW 14 23330935 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACCAGTCTTCTGCAGAATGC -3'
(R):5'- CCAGCTACGTCCCTGAAATC -3'

Sequencing Primer
(F):5'- GCAGAATGCACACCCTCC -3'
(R):5'- GCTACGTCCCTGAAATCATAGAG -3'
Posted On2019-06-26