Incidental Mutation 'R7172:Fhod3'
ID558384
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Nameformin homology 2 domain containing 3
SynonymsA930009H06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7172 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location24709445-25133500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25085546 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 789 (S789P)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097]
Predicted Effect probably damaging
Transcript: ENSMUST00000037097
AA Change: S789P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: S789P

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 A T 2: 122,638,318 Y33F probably damaging Het
Abca4 C T 3: 122,103,540 Q623* probably null Het
Abcb1a A T 5: 8,702,399 I457F probably benign Het
Abcb9 G A 5: 124,062,806 Q716* probably null Het
Abhd15 T C 11: 77,515,296 V33A probably benign Het
Abl2 A G 1: 156,622,587 D108G probably damaging Het
Adamts3 G A 5: 89,883,001 probably benign Het
Atmin G T 8: 116,956,542 V314L probably damaging Het
Axl G T 7: 25,786,974 Q102K probably benign Het
B020004J07Rik A G 4: 101,836,996 V230A probably benign Het
Cdhr5 A G 7: 141,271,928 S488P possibly damaging Het
Cnn1 C A 9: 22,105,494 A126D probably damaging Het
Col25a1 A T 3: 130,570,332 K537* probably null Het
Cxcl2 A G 5: 90,904,020 T26A probably benign Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhx36 T C 3: 62,501,015 D134G probably benign Het
Dnah17 T A 11: 118,041,131 K3672* probably null Het
Fadd G T 7: 144,582,171 H73Q probably benign Het
Fam35a G A 14: 34,237,568 T819I probably damaging Het
Fancm A G 12: 65,106,054 N1095D possibly damaging Het
Glis2 G A 16: 4,613,475 V289I probably benign Het
Gm17728 A C 17: 9,422,388 D110A probably damaging Het
Gm9602 T A 14: 4,777,282 S45T possibly damaging Het
Gpr137 A G 19: 6,939,681 S161P possibly damaging Het
Gpr89 C T 3: 96,880,069 probably null Het
Gps2 C T 11: 69,916,436 T306I probably benign Het
Hmcn1 A G 1: 150,753,699 Y936H possibly damaging Het
Hoxa5 A G 6: 52,204,296 Y19H probably damaging Het
Ifit2 G T 19: 34,573,494 A145S probably benign Het
Impdh2 G T 9: 108,560,610 C26F probably benign Het
Kcnh6 T C 11: 106,020,274 Y552H possibly damaging Het
Kcnma1 A T 14: 23,526,623 M254K probably damaging Het
Klhdc9 A T 1: 171,360,660 M1K probably null Het
Klk1b11 A T 7: 43,999,247 D194V possibly damaging Het
Lama1 A G 17: 67,804,545 I2264V Het
Lmntd2 A G 7: 141,213,641 S111P unknown Het
Megf8 T C 7: 25,343,667 L1338P probably damaging Het
Mipol1 G A 12: 57,325,535 E127K possibly damaging Het
Mmp25 A T 17: 23,644,788 C23S probably benign Het
Mup8 A T 4: 60,222,425 C15* probably null Het
Myh2 A T 11: 67,188,701 T995S probably benign Het
Myo1d C T 11: 80,592,795 V863I probably benign Het
N4bp1 A G 8: 86,860,424 probably null Het
Nat10 G T 2: 103,732,969 P562T probably damaging Het
Nedd9 C G 13: 41,316,804 R291P probably benign Het
Nlrc3 G T 16: 3,963,753 H613Q probably benign Het
Ntn1 A T 11: 68,385,667 C152S probably damaging Het
Olfr332 T A 11: 58,489,745 I337F unknown Het
Pam A T 1: 97,834,478 D793E probably benign Het
Patz1 T G 11: 3,308,032 V631G probably benign Het
Pcdh15 G A 10: 74,502,765 V1068M probably damaging Het
Prmt5 A G 14: 54,514,886 F151S possibly damaging Het
Pygo2 G A 3: 89,432,636 V114I probably benign Het
Rabgap1l A T 1: 160,733,586 S220R probably benign Het
Rdh7 T G 10: 127,888,349 S89R possibly damaging Het
Rgsl1 A C 1: 153,826,220 W163G possibly damaging Het
Ryr3 T A 2: 112,661,657 N3783I probably damaging Het
Slit1 A G 19: 41,634,666 L644P probably damaging Het
Steap2 A G 5: 5,682,896 S43P possibly damaging Het
Susd1 A T 4: 59,315,420 probably null Het
Tbc1d9 A G 8: 83,254,761 M686V probably damaging Het
Tdrp G A 8: 13,974,579 R22* probably null Het
Tmem245 A G 4: 56,903,946 V598A possibly damaging Het
Tnxb A G 17: 34,696,020 E1994G probably damaging Het
Trcg1 T A 9: 57,248,335 V757E probably benign Het
Trim10 A G 17: 36,870,063 E62G possibly damaging Het
Ushbp1 G T 8: 71,388,766 A473E possibly damaging Het
Vmn1r50 A C 6: 90,107,404 K44Q possibly damaging Het
Wdr75 A G 1: 45,799,134 N68D probably damaging Het
Wdr83 A G 8: 85,079,824 V115A probably damaging Het
Zdhhc17 A G 10: 111,009,948 L28P possibly damaging Het
Zfp738 C T 13: 67,670,408 C488Y probably damaging Het
Zfp987 T G 4: 146,122,002 L50W probably damaging Het
Zfyve28 G T 5: 34,234,409 R133S probably benign Het
Zscan20 G T 4: 128,585,676 C1007* probably null Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0570:Fhod3 UTSW 18 25112583 missense probably benign 0.27
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1621:Fhod3 UTSW 18 25022867 missense probably benign 0.35
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4667:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5832:Fhod3 UTSW 18 25090695 missense probably damaging 1.00
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R6414:Fhod3 UTSW 18 25090878 missense possibly damaging 0.64
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TACTCTTGTCTCCATCAGTAAGTGG -3'
(R):5'- AACTGAGGGAGTGAGCAGTTCC -3'

Sequencing Primer
(F):5'- TGTCTCCATCAGTAAGTGGTAAGGAC -3'
(R):5'- AGTGAGCAGTTCCCACAGTTC -3'
Posted On2019-06-26