Incidental Mutation 'R7173:Ext2'
ID558400
Institutional Source Beutler Lab
Gene Symbol Ext2
Ensembl Gene ENSMUSG00000027198
Gene Nameexostoses (multiple) 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location93661028-93822568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93813612 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 108 (I108N)
Ref Sequence ENSEMBL: ENSMUSP00000028623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000111248] [ENSMUST00000125407] [ENSMUST00000145838] [ENSMUST00000184931]
Predicted Effect probably damaging
Transcript: ENSMUST00000028623
AA Change: I108N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: I108N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 2.4e-59 PFAM
Pfam:Glyco_transf_64 456 701 1.1e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111248
AA Change: I108N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106879
Gene: ENSMUSG00000027198
AA Change: I108N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125407
AA Change: I108N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198
AA Change: I108N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 8.8e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145838
AA Change: I108N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122144
Gene: ENSMUSG00000027198
AA Change: I108N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 213 2.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184931
AA Change: I108N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198
AA Change: I108N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Ext2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Ext2 APN 2 93791073 missense probably benign
IGL01554:Ext2 APN 2 93811949 missense probably damaging 1.00
IGL01768:Ext2 APN 2 93791110 splice site probably benign
IGL02160:Ext2 APN 2 93813584 missense probably benign
IGL02677:Ext2 APN 2 93707245 missense probably damaging 1.00
IGL02939:Ext2 APN 2 93704619 splice site probably null
IGL03013:Ext2 APN 2 93707226 intron probably benign
IGL03286:Ext2 APN 2 93707272 missense probably damaging 1.00
R0018:Ext2 UTSW 2 93795692 missense probably damaging 1.00
R0526:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R0580:Ext2 UTSW 2 93795725 missense probably benign 0.31
R1383:Ext2 UTSW 2 93806113 missense possibly damaging 0.92
R1538:Ext2 UTSW 2 93707287 missense probably damaging 1.00
R1743:Ext2 UTSW 2 93730225 missense probably damaging 1.00
R1792:Ext2 UTSW 2 93704545 missense probably damaging 1.00
R2874:Ext2 UTSW 2 93739686 missense possibly damaging 0.95
R3122:Ext2 UTSW 2 93813825 missense probably damaging 1.00
R4624:Ext2 UTSW 2 93703200 missense probably benign 0.26
R4653:Ext2 UTSW 2 93696159 missense probably benign 0.22
R4826:Ext2 UTSW 2 93762630 missense probably benign 0.15
R4828:Ext2 UTSW 2 93795767 missense probably benign 0.08
R4936:Ext2 UTSW 2 93813679 nonsense probably null
R5311:Ext2 UTSW 2 93696261 missense probably benign 0.04
R5799:Ext2 UTSW 2 93811972 missense probably benign 0.01
R5850:Ext2 UTSW 2 93813659 missense possibly damaging 0.94
R6230:Ext2 UTSW 2 93762620 missense probably damaging 1.00
R6488:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R7047:Ext2 UTSW 2 93739657 missense probably damaging 0.99
R7391:Ext2 UTSW 2 93730267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGGTACCTGGAAAGCTG -3'
(R):5'- CCATTGAGTCCTCCAGTGATG -3'

Sequencing Primer
(F):5'- GCCGTCTCCTTTATTCGAAGGG -3'
(R):5'- CTCCAGTGATGGGGGTGTG -3'
Posted On2019-06-26