Incidental Mutation 'R7173:Kmt2e'
ID558410
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23464857 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 114 (Y114F)
Ref Sequence ENSEMBL: ENSMUSP00000092569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: Y114F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: Y114F

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: Y114F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: Y114F

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000196889
AA Change: Y114F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: Y114F

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTTCATCTACTAGACAGTGAC -3'
(R):5'- CAAAAGTGACCTTACTACCATTTCC -3'

Sequencing Primer
(F):5'- AGTGACATTAACTTATTACCACTGTG -3'
(R):5'- CTTTAATCCTAAGCACTCGGGAGG -3'
Posted On2019-06-26