Incidental Mutation 'R7173:Akap3'
ID558421
Institutional Source Beutler Lab
Gene Symbol Akap3
Ensembl Gene ENSMUSG00000030344
Gene NameA kinase (PRKA) anchor protein 3
SynonymsAkap110; Sob1; Fsp95
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_009650.2; MGI:1341149

Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location126853098-126874308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126864766 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 116 (V116A)
Ref Sequence ENSEMBL: ENSMUSP00000093091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095440] [ENSMUST00000202574] [ENSMUST00000202878]
Predicted Effect probably benign
Transcript: ENSMUST00000095440
AA Change: V116A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093091
Gene: ENSMUSG00000030344
AA Change: V116A

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202574
AA Change: V116A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144405
Gene: ENSMUSG00000030344
AA Change: V116A

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202878
AA Change: V116A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143794
Gene: ENSMUSG00000030344
AA Change: V116A

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Akap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Akap3 APN 6 126865731 missense probably benign 0.38
IGL01070:Akap3 APN 6 126865879 missense possibly damaging 0.93
IGL01975:Akap3 APN 6 126874000 missense probably damaging 1.00
IGL02114:Akap3 APN 6 126865996 missense probably damaging 0.99
IGL02349:Akap3 APN 6 126860263 missense probably benign 0.01
IGL03305:Akap3 APN 6 126864765 missense probably benign
IGL03412:Akap3 APN 6 126864725 missense probably benign 0.00
IGL03097:Akap3 UTSW 6 126866416 missense probably damaging 1.00
P0012:Akap3 UTSW 6 126864601 missense possibly damaging 0.87
R0358:Akap3 UTSW 6 126866812 missense probably damaging 1.00
R1123:Akap3 UTSW 6 126865966 missense probably benign 0.27
R1163:Akap3 UTSW 6 126864787 missense probably damaging 1.00
R1458:Akap3 UTSW 6 126865554 missense probably damaging 1.00
R1769:Akap3 UTSW 6 126865846 missense possibly damaging 0.67
R1967:Akap3 UTSW 6 126865098 missense probably benign 0.02
R4030:Akap3 UTSW 6 126865021 missense probably damaging 1.00
R4618:Akap3 UTSW 6 126866443 missense probably benign 0.31
R4677:Akap3 UTSW 6 126865263 missense probably damaging 0.99
R4735:Akap3 UTSW 6 126865638 missense probably damaging 1.00
R5660:Akap3 UTSW 6 126865291 missense probably damaging 1.00
R5834:Akap3 UTSW 6 126865833 missense probably benign 0.04
R5847:Akap3 UTSW 6 126865558 missense probably damaging 1.00
R6053:Akap3 UTSW 6 126866533 missense probably damaging 0.98
R7007:Akap3 UTSW 6 126866476 missense probably damaging 0.99
R7070:Akap3 UTSW 6 126874024 missense probably damaging 1.00
R7123:Akap3 UTSW 6 126866304 missense probably benign 0.05
R7238:Akap3 UTSW 6 126865237 missense probably benign 0.00
X0028:Akap3 UTSW 6 126865917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCAGGACTCGAGGTTCAAG -3'
(R):5'- TTGGAACATGCGGTGACTG -3'

Sequencing Primer
(F):5'- TTCAAGCCTGGAGAGTCATCG -3'
(R):5'- GAGGCCACTGTACTCAAGCTTTTG -3'
Posted On2019-06-26