Incidental Mutation 'R7173:Enpp3'
ID558434
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 3
SynonymsCD203c
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R7173 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24772406-24842823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24774047 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 827 (V827G)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: V827G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: V827G

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24787772 missense probably benign 0.00
IGL00778:Enpp3 APN 10 24798262 missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24774907 missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24805922 nonsense probably null
IGL01642:Enpp3 APN 10 24798269 missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24792025 missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24776794 missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24774002 missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24791983 splice site probably benign
IGL02517:Enpp3 APN 10 24809848 splice site probably benign
IGL02956:Enpp3 APN 10 24774943 splice site probably benign
R0017:Enpp3 UTSW 10 24799153 splice site probably null
R0042:Enpp3 UTSW 10 24774824 missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24776869 missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24804436 missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24820597 missense probably benign 0.00
R0450:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24795716 missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24784953 splice site probably benign
R1261:Enpp3 UTSW 10 24774934 missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24795782 missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24778789 missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24776771 nonsense probably null
R1966:Enpp3 UTSW 10 24807491 missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24776878 missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24805895 missense probably benign 0.00
R2380:Enpp3 UTSW 10 24776872 missense probably benign
R2410:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R3794:Enpp3 UTSW 10 24831732 splice site probably null
R3896:Enpp3 UTSW 10 24777949 missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24793589 missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24776882 missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24773927 missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24798277 missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24807538 missense probably benign 0.01
R5045:Enpp3 UTSW 10 24776767 missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24809916 missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24808160 missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24778821 missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24774842 missense probably benign 0.37
R6117:Enpp3 UTSW 10 24787852 missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24808191 missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24777957 missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24807453 missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24809870 missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24808166 missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24826195 missense probably damaging 0.99
R7224:Enpp3 UTSW 10 24776884 missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24817844 missense unknown
X0026:Enpp3 UTSW 10 24826242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTTTCTGCCAAATACTGAC -3'
(R):5'- CAGCACAGTGGGTAGGAGTTTATAG -3'

Sequencing Primer
(F):5'- AATGTCACCAGCTCTATAGGACTCTG -3'
(R):5'- TACACCACGGGGAAAATG -3'
Posted On2019-06-26