Incidental Mutation 'R7173:Olfr206'
ID558456
Institutional Source Beutler Lab
Gene Symbol Olfr206
Ensembl Gene ENSMUSG00000066257
Gene Nameolfactory receptor 206
SynonymsMOR182-4, GA_x54KRFPKG5P-55560552-55559632
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59344675-59349246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59345147 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 185 (T185A)
Ref Sequence ENSEMBL: ENSMUSP00000146906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084791] [ENSMUST00000207927]
Predicted Effect probably benign
Transcript: ENSMUST00000084791
AA Change: T185A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081849
Gene: ENSMUSG00000066257
AA Change: T185A

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 6.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 34 295 2.6e-5 PFAM
Pfam:7tm_1 40 289 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207927
AA Change: T185A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Pcsk5 T C 19: 17,477,877 Y1063C possibly damaging Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Olfr206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Olfr206 APN 16 59345161 missense probably damaging 0.97
IGL02106:Olfr206 APN 16 59345024 missense probably benign 0.00
IGL02839:Olfr206 APN 16 59345390 missense probably benign 0.01
IGL03010:Olfr206 APN 16 59344772 utr 3 prime probably benign
R1163:Olfr206 UTSW 16 59345062 missense probably damaging 0.99
R1507:Olfr206 UTSW 16 59345493 missense probably damaging 1.00
R1670:Olfr206 UTSW 16 59345427 missense possibly damaging 0.79
R2881:Olfr206 UTSW 16 59344852 missense probably damaging 1.00
R2925:Olfr206 UTSW 16 59345343 nonsense probably null
R4479:Olfr206 UTSW 16 59344867 missense probably damaging 0.99
R4891:Olfr206 UTSW 16 59345471 missense possibly damaging 0.87
R5085:Olfr206 UTSW 16 59345086 missense probably damaging 0.99
R5099:Olfr206 UTSW 16 59344903 missense probably benign 0.00
R5218:Olfr206 UTSW 16 59344907 missense probably benign
R6019:Olfr206 UTSW 16 59345435 missense possibly damaging 0.48
R6773:Olfr206 UTSW 16 59345216 missense probably damaging 1.00
R7068:Olfr206 UTSW 16 59345204 missense possibly damaging 0.94
R7192:Olfr206 UTSW 16 59345179 missense probably benign 0.44
R7485:Olfr206 UTSW 16 59345324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCACGTACATGAAGAGG -3'
(R):5'- AGCCATATGCAACCCTCTGC -3'

Sequencing Primer
(F):5'- CTCACGTACATGAAGAGGAGGGTAC -3'
(R):5'- CTCTATCTAGTGGTGATGTCCAAAAG -3'
Posted On2019-06-26