Incidental Mutation 'R7173:Pcsk5'
ID558461
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7173 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17477877 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1063 (Y1063C)
Ref Sequence ENSEMBL: ENSMUSP00000025618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025618
AA Change: Y1063C

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: Y1063C

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,949,647 V403I possibly damaging Het
Actn1 G A 12: 80,177,259 R475C possibly damaging Het
Adam11 T C 11: 102,771,931 L191P possibly damaging Het
Adam21 G T 12: 81,559,234 Q585K probably benign Het
Akap3 T C 6: 126,864,766 V116A probably benign Het
Alpk1 A T 3: 127,684,375 Y74* probably null Het
Alx4 G T 2: 93,642,857 G67C possibly damaging Het
Ankrd17 A T 5: 90,260,117 C1414S possibly damaging Het
Ankrd44 T C 1: 54,766,391 D170G probably damaging Het
Arpc2 T A 1: 74,264,372 M266K probably damaging Het
Atp12a A T 14: 56,384,380 N794I probably damaging Het
Cabin1 A G 10: 75,746,562 L340P probably benign Het
Ccer1 A T 10: 97,693,355 probably benign Het
Cfap73 A T 5: 120,634,214 Y8N probably damaging Het
Cln3 T C 7: 126,579,417 T173A probably damaging Het
Cxcl3 A T 5: 90,786,149 probably benign Het
Cyp2c66 G C 19: 39,170,957 C284S probably benign Het
Dnajc22 T C 15: 99,101,306 V124A probably benign Het
Dync1h1 C G 12: 110,601,739 D45E probably benign Het
Elmod3 A T 6: 72,577,252 probably null Het
Enpp3 A C 10: 24,774,047 V827G probably damaging Het
Esyt2 T C 12: 116,363,534 I574T probably benign Het
Ext2 A T 2: 93,813,612 I108N probably damaging Het
Fam186a T C 15: 99,945,650 I904M unknown Het
Fam192a A T 8: 94,588,858 F15L probably damaging Het
Fmnl2 T C 2: 53,114,190 I638T unknown Het
Fndc3c1 G C X: 106,435,073 L724V possibly damaging Het
Fras1 G T 5: 96,778,078 A3714S probably damaging Het
Fsd1 C A 17: 55,996,696 R479S possibly damaging Het
Gaa C T 11: 119,278,991 L624F probably damaging Het
Galnt2 G A 8: 124,305,553 V86I probably benign Het
Gdap1l1 T G 2: 163,438,688 V48G probably damaging Het
Gm10549 A G 18: 33,464,409 T83A unknown Het
Gm11437 T G 11: 84,164,548 T81P probably benign Het
Gm16253 T C 3: 96,580,663 probably null Het
Gm4788 C A 1: 139,731,677 E705* probably null Het
Gprc6a A T 10: 51,628,499 M83K probably benign Het
Grik5 T C 7: 25,068,162 D31G probably damaging Het
Hcrtr2 A G 9: 76,259,731 L108P probably damaging Het
Herc2 T A 7: 56,203,827 L3689Q probably damaging Het
Igf2bp1 T C 11: 95,968,464 M407V probably benign Het
Irgq A T 7: 24,533,760 E342V probably damaging Het
Itih2 A T 2: 10,105,163 I593N probably damaging Het
Ivd G T 2: 118,871,389 G101C probably damaging Het
Jakmip1 G A 5: 37,091,364 G123S probably damaging Het
Kif14 T A 1: 136,479,170 I580N probably damaging Het
Kmt2e A T 5: 23,464,857 Y114F probably damaging Het
Ly6g5b C A 17: 35,114,704 C99F probably damaging Het
Map3k20 C T 2: 72,441,414 P629S probably benign Het
Mpl A G 4: 118,448,544 probably null Het
Muc4 T C 16: 32,762,488 F476L probably damaging Het
Mup18 T C 4: 61,671,962 T110A probably benign Het
Nlrp9a A G 7: 26,558,178 D407G probably benign Het
Nmur1 G A 1: 86,386,468 R359C probably benign Het
Olfr206 T C 16: 59,345,147 T185A probably benign Het
Olfr488 C T 7: 108,255,748 C130Y possibly damaging Het
Panx3 A T 9: 37,661,300 M318K probably damaging Het
Pcnx T C 12: 81,953,003 probably null Het
Rere G A 4: 150,468,738 R129H probably damaging Het
Rpgrip1 A G 14: 52,112,176 Y7C possibly damaging Het
Serpina6 T C 12: 103,646,994 N349S possibly damaging Het
Slc10a1 T G 12: 80,955,976 E296A probably damaging Het
Slc2a9 A T 5: 38,452,871 probably null Het
Sptan1 T A 2: 29,983,209 M138K probably benign Het
Tbl3 T C 17: 24,705,259 T175A probably benign Het
Tbrg4 T C 11: 6,620,810 T221A possibly damaging Het
Tenm2 T C 11: 36,041,551 T1739A probably damaging Het
Tmed5 T C 5: 108,132,321 D35G probably benign Het
Tnfsf15 A T 4: 63,729,652 S250R probably damaging Het
Tnpo2 G T 8: 85,055,078 V830F probably benign Het
Ttbk2 G T 2: 120,740,111 S1187Y probably damaging Het
Ttn G A 2: 76,794,685 T15183M possibly damaging Het
Tubgcp3 T C 8: 12,639,259 probably null Het
Vmn1r38 T C 6: 66,776,294 I279M possibly damaging Het
Vmn1r49 A T 6: 90,072,268 Y251N possibly damaging Het
Vmn1r66 C T 7: 10,274,555 V184I probably benign Het
Vmn2r26 T A 6: 124,061,296 M610K probably benign Het
Xrn2 C T 2: 147,042,093 P591S probably damaging Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCAAGATTCCTAGACACC -3'
(R):5'- CTGTTCAAATATCATTTCTGGGCAG -3'

Sequencing Primer
(F):5'- CCAGTGTCAAGATGGATGACTTCC -3'
(R):5'- ATCATTTCTGGGCAGTACATTTC -3'
Posted On2019-06-26