Incidental Mutation 'R7174:Lrriq1'
ID558501
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7174 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103224965 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 92 (N92S)
Ref Sequence ENSEMBL: ENSMUSP00000020043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect probably benign
Transcript: ENSMUST00000020043
AA Change: N92S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: N92S

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
AA Change: N92S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: N92S

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: N92S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: N92S

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam5 T A 7: 17,757,914 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr533 T C 7: 140,467,163 *321Q probably null Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Olfr730 T C 14: 50,186,696 I175V probably benign Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Prmt2 G T 10: 76,225,339 D104E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Spata31d1d A T 13: 59,728,580 N380K possibly damaging Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Taf7 A T 18: 37,643,000 S171R probably damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Vmn2r53 A T 7: 12,581,701 H730Q probably benign Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGGCAATAAACTAACATCCTATG -3'
(R):5'- CTGTCTAGACTATGAAAAGTGATAGC -3'

Sequencing Primer
(F):5'- TAGGAGCCCTTCCATTCAG -3'
(R):5'- AGCAAGACAGTGAGTATTTTTAGAAG -3'
Posted On2019-06-26