Incidental Mutation 'R7174:Taf7'
ID558521
Institutional Source Beutler Lab
Gene Symbol Taf7
Ensembl Gene ENSMUSG00000051316
Gene NameTATA-box binding protein associated factor 7
Synonyms55kDa, Taf2f, TAFII55
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7174 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37640491-37644204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37643000 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 171 (S171R)
Ref Sequence ENSEMBL: ENSMUSP00000065645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058635] [ENSMUST00000066272] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000058635
SMART Domains Protein: ENSMUSP00000052849
Gene: ENSMUSG00000050304

DomainStartEndE-ValueType
Pfam:Mito_carr 1 60 5.9e-11 PFAM
Pfam:Mito_carr 67 165 9.5e-20 PFAM
Pfam:Mito_carr 169 262 8.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066272
AA Change: S171R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065645
Gene: ENSMUSG00000051316
AA Change: S171R

DomainStartEndE-ValueType
TAFII55_N 12 178 4.63e-94 SMART
low complexity region 225 235 N/A INTRINSIC
coiled coil region 237 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E5.5. Mice homozygous for a conditional allele activated in thymocytes exhibit impaired T cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik C A 5: 145,044,817 A154E probably benign Het
Adamts1 C A 16: 85,799,172 A419S probably benign Het
Arap2 C G 5: 62,604,278 V1702L probably benign Het
Arpc1a C T 5: 145,097,277 P152S probably benign Het
Bbs10 T A 10: 111,300,767 C580* probably null Het
Bcam A G 7: 19,765,451 Y216H probably damaging Het
C2cd3 T C 7: 100,432,198 S1016P Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam5 T A 7: 17,757,914 probably null Het
Cfap57 A G 4: 118,589,067 V666A probably benign Het
Cntn3 A G 6: 102,165,344 F1021L probably benign Het
Cr1l C T 1: 195,129,189 G119D probably benign Het
Fgf10 A T 13: 118,715,406 H8L probably benign Het
Fras1 T A 5: 96,755,577 probably null Het
Frem1 G T 4: 82,922,256 T1811N probably benign Het
Fsd1 A T 17: 55,991,356 Q227L probably benign Het
Galk2 A G 2: 125,896,701 I138M probably damaging Het
Gm5152 T C 5: 10,245,270 K56E probably damaging Het
Igkv8-30 A G 6: 70,117,598 V7A possibly damaging Het
Katnb1 G A 8: 95,097,441 A450T probably benign Het
Kif14 A T 1: 136,521,257 E1465V possibly damaging Het
Klra3 A T 6: 130,335,978 probably null Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Lepr A G 4: 101,750,338 N251S probably benign Het
Lrp2 T C 2: 69,433,072 M4379V probably benign Het
Lrriq1 T C 10: 103,224,965 N92S probably benign Het
Map3k13 A G 16: 21,926,256 N855S probably damaging Het
Marf1 T A 16: 14,136,953 D900V probably damaging Het
Nckap5l A T 15: 99,424,003 M1087K probably benign Het
Nlrp9c T C 7: 26,385,297 N286D probably benign Het
Olfr1009 C T 2: 85,721,953 P183S possibly damaging Het
Olfr159 C T 4: 43,770,691 A107T not run Het
Olfr497 T A 7: 108,423,160 S196R probably benign Het
Olfr533 T C 7: 140,467,163 *321Q probably null Het
Olfr615 A T 7: 103,561,391 R305* probably null Het
Olfr730 T C 14: 50,186,696 I175V probably benign Het
Pcdhga3 A G 18: 37,675,927 T478A probably benign Het
Pdgfrb T C 18: 61,066,515 I385T probably benign Het
Poteg C T 8: 27,453,277 R192W probably benign Het
Prmt2 G T 10: 76,225,339 D104E probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rlbp1 T C 7: 79,377,342 N190S possibly damaging Het
Ryr2 T C 13: 11,801,177 D641G possibly damaging Het
Sh3gl1 A T 17: 56,017,846 M303K probably benign Het
Slc26a5 A G 5: 21,813,894 V649A probably damaging Het
Slco4c1 T C 1: 96,837,598 N376D possibly damaging Het
Socs3 A T 11: 117,967,727 Y168* probably null Het
Spata31d1d A T 13: 59,728,580 N380K possibly damaging Het
Ssbp3 A G 4: 107,037,646 N254S probably benign Het
Stard10 C T 7: 101,346,019 S326L probably damaging Het
Taf2 T C 15: 55,048,739 D524G possibly damaging Het
Tchh C T 3: 93,446,171 R973C unknown Het
Tmem67 T C 4: 12,077,337 R172G possibly damaging Het
Top2a C A 11: 99,024,096 probably benign Het
Ttc8 T A 12: 98,974,701 N323K possibly damaging Het
Txnl1 T C 18: 63,671,596 N276D probably benign Het
Usp24 T G 4: 106,362,681 probably null Het
Vmn1r18 A C 6: 57,389,624 probably null Het
Vmn2r53 A T 7: 12,581,701 H730Q probably benign Het
Wnk1 A C 6: 119,970,978 I500M probably damaging Het
Zfp335 A T 2: 164,902,503 Y451N probably damaging Het
Zfp683 T A 4: 134,055,753 I176N probably damaging Het
Other mutations in Taf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Taf7 APN 18 37643433 missense probably damaging 1.00
IGL02123:Taf7 APN 18 37642480 intron probably benign
IGL02155:Taf7 APN 18 37643511 start codon destroyed probably null 0.95
IGL02291:Taf7 APN 18 37643362 missense possibly damaging 0.76
R3961:Taf7 UTSW 18 37643121 missense probably benign 0.29
R4590:Taf7 UTSW 18 37642731 missense possibly damaging 0.75
R5629:Taf7 UTSW 18 37643502 missense probably benign
R5982:Taf7 UTSW 18 37643445 missense probably damaging 1.00
R6492:Taf7 UTSW 18 37643106 missense probably damaging 1.00
R6896:Taf7 UTSW 18 37642680 missense possibly damaging 0.88
R6944:Taf7 UTSW 18 37642857 missense probably damaging 1.00
R7154:Taf7 UTSW 18 37642548 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CTGCTGCTGAGGTCATTGAATATC -3'
(R):5'- TAGCCACAGTAGATGGTGACC -3'

Sequencing Primer
(F):5'- GAATATCTCTCGAAGCTCATCATGC -3'
(R):5'- AGTAGATGGTGACCTATACCCTC -3'
Posted On2019-06-26