Incidental Mutation 'R7176:Kbtbd7'
ID558639
Institutional Source Beutler Lab
Gene Symbol Kbtbd7
Ensembl Gene ENSMUSG00000043881
Gene Namekelch repeat and BTB (POZ) domain containing 7
Synonyms1110008P08Rik, LOC211255
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7176 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location79426511-79431036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79427754 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 342 (E342V)
Ref Sequence ENSEMBL: ENSMUSP00000060768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]
Predicted Effect probably benign
Transcript: ENSMUST00000022600
SMART Domains Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

DomainStartEndE-ValueType
low complexity region 104 119 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
PCRF 139 255 5.96e-27 SMART
Pfam:RF-1 290 400 2.6e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000061222
AA Change: E342V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881
AA Change: E342V

DomainStartEndE-ValueType
Blast:BTB 11 44 2e-11 BLAST
BTB 63 168 1.05e-23 SMART
BACK 173 279 1.41e-19 SMART
low complexity region 317 340 N/A INTRINSIC
Pfam:Kelch_1 434 481 1.7e-9 PFAM
low complexity region 657 676 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator, having been shown to increase the transcription of activator protein-1 and serum response element. The encoded protein can also form a complex with KBTBD6 and CUL3, which regulates the ubiquitylation and degradation of TIAM1, which is a regulator of RAC1. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,277 H267N probably benign Het
Abtb2 A G 2: 103,709,375 D695G probably benign Het
Adam21 C T 12: 81,560,248 D247N possibly damaging Het
Adnp T C 2: 168,182,658 N906D probably benign Het
Ankrd17 A T 5: 90,268,735 H1079Q probably damaging Het
Aqp3 T A 4: 41,095,202 N60Y probably damaging Het
Art4 T G 6: 136,857,168 T26P probably benign Het
Arvcf T C 16: 18,399,727 L553P probably damaging Het
Asxl1 T A 2: 153,401,988 I1487N probably damaging Het
Capn3 A T 2: 120,504,492 Y820F possibly damaging Het
Catip A G 1: 74,362,782 T39A probably damaging Het
Ccdc18 T A 5: 108,168,106 C481S probably benign Het
Ccnf A G 17: 24,249,402 I7T possibly damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdkl4 A T 17: 80,543,792 Y160* probably null Het
Celsr3 C T 9: 108,845,762 P2783S probably benign Het
Cisd3 A T 11: 97,686,133 D11V probably benign Het
Daxx A T 17: 33,913,318 H512L unknown Het
Dip2b A G 15: 100,169,318 H567R probably damaging Het
Dnah7c C A 1: 46,430,809 A18E probably benign Het
Eif3d A T 15: 77,963,234 V268D probably damaging Het
Eif4g3 T A 4: 138,171,186 H1089Q probably damaging Het
Fmnl2 A G 2: 53,114,150 M625V unknown Het
Foxn1 T C 11: 78,360,867 R513G possibly damaging Het
Gemin5 C T 11: 58,166,002 V134I probably benign Het
Gm8251 A T 1: 44,060,346 S531T probably benign Het
Gtf2h3 A G 5: 124,590,370 R161G probably damaging Het
Ice1 A G 13: 70,624,406 probably null Het
Il1rl1 T C 1: 40,446,606 Y306H probably damaging Het
Kyat3 A T 3: 142,737,839 K404N possibly damaging Het
Lins1 T C 7: 66,713,805 W483R probably benign Het
Lipo2 A G 19: 33,745,807 I194T possibly damaging Het
Mcm8 G T 2: 132,820,072 A137S probably benign Het
Mdm1 C A 10: 118,142,865 Q12K probably damaging Het
Mrgprb5 C A 7: 48,168,311 L225F possibly damaging Het
Myh11 T A 16: 14,215,826 H1068L Het
Ngef A T 1: 87,480,695 V550E possibly damaging Het
Nrg1 G A 8: 31,968,036 Q84* probably null Het
Obp2b G T 2: 25,737,748 V59L possibly damaging Het
Ocln C A 13: 100,515,082 G327C probably damaging Het
Ocln A C 13: 100,515,083 N326K probably benign Het
Olfr1117-ps1 C T 2: 87,285,034 A248V probably damaging Het
Otogl T C 10: 107,778,911 D1960G probably damaging Het
Pik3c2a T C 7: 116,388,096 D530G possibly damaging Het
Plod1 A T 4: 147,913,287 M655K probably benign Het
Ppp4r3b A G 11: 29,198,904 N449D probably damaging Het
Ppp6r3 G T 19: 3,471,989 T563K probably damaging Het
Prepl T A 17: 85,069,026 L533F probably benign Het
Rbl1 G A 2: 157,188,325 R421W probably damaging Het
Rrp15 G A 1: 186,721,533 S239L probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 A G 5: 124,392,881 S815P probably benign Het
Scn7a G A 2: 66,676,288 T1419I probably damaging Het
Setdb1 A G 3: 95,337,147 probably null Het
Shpk A G 11: 73,222,988 H409R probably benign Het
Slamf6 A C 1: 171,934,291 N93T probably benign Het
Slc27a4 A G 2: 29,811,226 N343S probably benign Het
Slc35g1 T A 19: 38,403,323 V351E probably damaging Het
Smcr8 A T 11: 60,778,946 I307F probably damaging Het
Spats2l T C 1: 57,937,918 I305T possibly damaging Het
Speer4c T C 5: 15,711,538 T144A probably benign Het
Tbl3 G A 17: 24,700,758 T774I probably benign Het
Ush2a A G 1: 188,537,728 H1724R probably benign Het
Vcan A G 13: 89,688,936 S2830P probably benign Het
Vmn2r27 T A 6: 124,192,036 I712F probably benign Het
Wdr59 T G 8: 111,492,756 Q223P Het
Zfp28 T A 7: 6,383,457 C22S possibly damaging Het
Zfp536 T G 7: 37,480,851 probably null Het
Other mutations in Kbtbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Kbtbd7 APN 14 79428612 missense probably damaging 0.98
IGL01364:Kbtbd7 APN 14 79428046 missense possibly damaging 0.82
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0973:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R0974:Kbtbd7 UTSW 14 79427430 missense possibly damaging 0.48
R1236:Kbtbd7 UTSW 14 79427832 missense probably benign 0.05
R2909:Kbtbd7 UTSW 14 79428482 missense probably benign 0.16
R4731:Kbtbd7 UTSW 14 79428800 makesense probably null
R4732:Kbtbd7 UTSW 14 79428800 makesense probably null
R4733:Kbtbd7 UTSW 14 79428800 makesense probably null
R4984:Kbtbd7 UTSW 14 79427162 missense probably damaging 1.00
R5712:Kbtbd7 UTSW 14 79428765 missense possibly damaging 0.86
R6699:Kbtbd7 UTSW 14 79428192 missense probably benign 0.31
R7122:Kbtbd7 UTSW 14 79428317 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGAGCAAGCCTATTGTGAAG -3'
(R):5'- CACCCATAGGTCTTTCCTGG -3'

Sequencing Primer
(F):5'- GCCTATTGTGAAGAAATACTGCCTGG -3'
(R):5'- CAGCAAGATAGATGTCATGGTCTG -3'
Posted On2019-06-26