Incidental Mutation 'R7177:Ncaph'
ID558663
Institutional Source Beutler Lab
Gene Symbol Ncaph
Ensembl Gene ENSMUSG00000034906
Gene Namenon-SMC condensin I complex, subunit H
SynonymsA730011O11Rik, HCAP-H, Brrn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127103809-127133954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127116586 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 504 (D504E)
Ref Sequence ENSEMBL: ENSMUSP00000106017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110387]
Predicted Effect probably damaging
Transcript: ENSMUST00000110387
AA Change: D504E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106017
Gene: ENSMUSG00000034906
AA Change: D504E

DomainStartEndE-ValueType
Pfam:Cnd2 25 729 9e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175885
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the barr gene family and a regulatory subunit of the condensin complex. This complex is required for the conversion of interphase chromatin into condensed chromosomes. The protein encoded by this gene is associated with mitotic chromosomes, except during the early phase of chromosome condensation. During interphase, the protein has a distinct punctate nucleolar localization. Alternatively spliced transcript variants encoding different proteins have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice die before E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Ankrd27 T C 7: 35,619,397 I571T probably damaging Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Ncaph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Ncaph APN 2 127126105 splice site probably benign
IGL02619:Ncaph APN 2 127127536 missense probably damaging 0.99
IGL02674:Ncaph APN 2 127113576 missense probably damaging 0.98
IGL02679:Ncaph APN 2 127124864 missense possibly damaging 0.95
R2060:Ncaph UTSW 2 127124875 missense probably damaging 1.00
R3508:Ncaph UTSW 2 127127193 missense probably benign 0.33
R4283:Ncaph UTSW 2 127121085 intron probably benign
R4761:Ncaph UTSW 2 127106116 missense probably benign 0.07
R4957:Ncaph UTSW 2 127121257 missense possibly damaging 0.46
R5491:Ncaph UTSW 2 127123675 missense probably benign
R5942:Ncaph UTSW 2 127116688 intron probably null
R6523:Ncaph UTSW 2 127105889 missense probably damaging 0.97
R7188:Ncaph UTSW 2 127122114 missense probably benign 0.09
X0021:Ncaph UTSW 2 127127138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAGCAGGCAGAGCTCTC -3'
(R):5'- ACAAAGTCAGTGGCAGGGTC -3'

Sequencing Primer
(F):5'- AGGGCTCTGCAGTCTCTGTC -3'
(R):5'- TTTAGATAGGGTAGCACCATGTAGCC -3'
Posted On2019-06-26