Incidental Mutation 'R7177:Ankrd27'
ID558684
Institutional Source Beutler Lab
Gene Symbol Ankrd27
Ensembl Gene ENSMUSG00000034867
Gene Nameankyrin repeat domain 27 (VPS9 domain)
SynonymsD330003H11Rik, Varp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7177 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35586244-35639226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35619397 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 571 (I571T)
Ref Sequence ENSEMBL: ENSMUSP00000041751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040844] [ENSMUST00000190503] [ENSMUST00000206472] [ENSMUST00000206632]
Predicted Effect probably damaging
Transcript: ENSMUST00000040844
AA Change: I571T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041751
Gene: ENSMUSG00000034867
AA Change: I571T

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 8e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 742 774 8.39e-3 SMART
ANK 775 804 5.93e-3 SMART
ANK 808 837 4.46e-7 SMART
ANK 841 870 2.81e-4 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000190503
AA Change: I571T

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140259
Gene: ENSMUSG00000034867
AA Change: I571T

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 7e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 687 719 8.39e-3 SMART
ANK 720 749 5.93e-3 SMART
ANK 753 782 4.46e-7 SMART
ANK 786 815 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206472
Predicted Effect probably benign
Transcript: ENSMUST00000206632
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik T A 8: 45,970,407 E89D possibly damaging Het
4930550C14Rik T C 9: 53,414,385 L74S probably damaging Het
4933406M09Rik T C 1: 134,390,425 S312P probably benign Het
5730409E04Rik A G 4: 126,611,732 S18G probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
Aff4 C T 11: 53,406,639 S896L probably benign Het
Bdp1 C A 13: 100,049,970 R1658I probably damaging Het
Carm1 C T 9: 21,547,027 T7M unknown Het
Ccdc105 T C 10: 78,752,490 D162G probably damaging Het
Ccdc183 A G 2: 25,616,284 V100A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Ceacam2 T G 7: 25,520,916 D239A probably benign Het
Cmya5 T C 13: 93,095,328 D1084G probably benign Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col20a1 C T 2: 180,994,214 Q211* probably null Het
Col9a1 T A 1: 24,195,417 L13Q unknown Het
Cracr2a A T 6: 127,608,706 M156L probably benign Het
Cts8 C T 13: 61,251,691 M151I possibly damaging Het
Cyp2ab1 A T 16: 20,316,719 L11Q probably null Het
Dhrs13 T A 11: 78,034,382 C160S probably benign Het
Enthd1 T A 15: 80,474,214 E368D probably damaging Het
Fbxo18 A G 2: 11,755,711 I676T probably damaging Het
Fcgrt T C 7: 45,101,997 R176G probably benign Het
Gatd1 A G 7: 141,411,034 F67L possibly damaging Het
Gm4353 G A 7: 116,084,492 P23S probably damaging Het
Gm6882 T A 7: 21,427,752 I64F possibly damaging Het
Grwd1 A T 7: 45,830,780 M1K probably null Het
Hook2 T A 8: 84,991,417 S58T probably benign Het
Iqch T G 9: 63,421,835 *1072C probably null Het
Kmt2d G A 15: 98,850,386 T3019I unknown Het
Lmx1a T C 1: 167,846,678 S356P probably benign Het
Lrig3 A G 10: 126,006,843 M546V probably benign Het
Lrrc1 C A 9: 77,472,222 E96* probably null Het
Lrtm2 C A 6: 119,317,152 M339I probably damaging Het
Map10 T C 8: 125,671,845 V659A probably benign Het
Map7d1 A G 4: 126,236,985 C384R probably damaging Het
Mcur1 T C 13: 43,544,536 D296G probably damaging Het
Mettl24 A T 10: 40,810,512 H295L probably damaging Het
Mpl A G 4: 118,448,544 probably null Het
Mrps5 T C 2: 127,595,697 V148A probably benign Het
N4bp2 T C 5: 65,807,548 V980A probably damaging Het
Ncaph A T 2: 127,116,586 D504E probably damaging Het
Nxph1 A G 6: 9,247,497 N156S probably damaging Het
Odf3l1 T A 9: 56,849,978 M139L possibly damaging Het
Olfr1307 T A 2: 111,945,156 Q100L probably damaging Het
Olfr1395 T A 11: 49,149,185 C309* probably null Het
Pafah1b3 T A 7: 25,295,232 I186L probably benign Het
Papola C A 12: 105,809,531 N235K possibly damaging Het
Pcnx3 A T 19: 5,687,499 M98K probably benign Het
Pkhd1l1 A G 15: 44,467,404 N125S probably damaging Het
Pls1 T A 9: 95,773,559 H380L probably benign Het
Plxna1 T C 6: 89,323,329 T1591A possibly damaging Het
Pparg T G 6: 115,441,620 S147A probably benign Het
Prdm10 T C 9: 31,367,707 S1025P probably benign Het
Prkcd T A 14: 30,599,707 H510L probably damaging Het
Ptprh T A 7: 4,569,481 E499D possibly damaging Het
Rad51ap1 A G 6: 126,925,020 S256P probably benign Het
Rad54b A G 4: 11,599,755 T320A probably damaging Het
Rnf207 A G 4: 152,312,177 I459T probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Ryr3 A T 2: 112,900,843 D727E probably damaging Het
Sdk2 C T 11: 113,829,969 R1378H possibly damaging Het
Slc7a11 A G 3: 50,443,231 S11P probably benign Het
Sox4 A G 13: 28,953,017 V2A probably damaging Het
Srf A G 17: 46,555,392 F146S probably damaging Het
Srrm2 T C 17: 23,816,773 V797A unknown Het
Stk32c T C 7: 139,104,302 D463G possibly damaging Het
Syne2 C A 12: 75,971,880 Y3384* probably null Het
Tmem55b A C 14: 50,930,177 M104R possibly damaging Het
Traip T A 9: 107,960,985 M139K possibly damaging Het
Trappc2l T A 8: 122,614,312 F100Y probably damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Uty A G Y: 1,099,691 V1168A probably benign Het
Vmn2r25 T C 6: 123,839,923 D233G possibly damaging Het
Zdbf2 C T 1: 63,294,961 R31C possibly damaging Het
Other mutations in Ankrd27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ankrd27 APN 7 35614456 missense probably damaging 0.99
IGL02205:Ankrd27 APN 7 35616939 missense probably damaging 1.00
IGL02372:Ankrd27 APN 7 35633036 unclassified probably null
IGL02629:Ankrd27 APN 7 35625696 missense probably benign 0.00
IGL03394:Ankrd27 APN 7 35607098 splice site probably null
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0281:Ankrd27 UTSW 7 35619371 missense probably damaging 0.98
R0373:Ankrd27 UTSW 7 35638053 missense probably benign 0.00
R0833:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R0836:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R1191:Ankrd27 UTSW 7 35602487 missense probably damaging 0.96
R1394:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1395:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1493:Ankrd27 UTSW 7 35608365 missense probably benign 0.11
R1648:Ankrd27 UTSW 7 35603853 missense probably benign 0.00
R1664:Ankrd27 UTSW 7 35607126 missense probably damaging 1.00
R1698:Ankrd27 UTSW 7 35614521 missense probably benign 0.01
R1717:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R1919:Ankrd27 UTSW 7 35632985 missense probably benign
R1956:Ankrd27 UTSW 7 35603839 missense probably damaging 1.00
R2276:Ankrd27 UTSW 7 35615840 unclassified probably benign
R3000:Ankrd27 UTSW 7 35608330 missense probably damaging 1.00
R4604:Ankrd27 UTSW 7 35628490 missense probably damaging 1.00
R4647:Ankrd27 UTSW 7 35638234 missense probably benign
R4838:Ankrd27 UTSW 7 35591806 missense possibly damaging 0.87
R4896:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R4973:Ankrd27 UTSW 7 35632992 missense probably benign
R5004:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R5069:Ankrd27 UTSW 7 35628435 missense probably damaging 0.98
R5182:Ankrd27 UTSW 7 35628487 missense probably damaging 1.00
R5330:Ankrd27 UTSW 7 35615926 nonsense probably null
R5458:Ankrd27 UTSW 7 35591811 missense probably damaging 1.00
R6293:Ankrd27 UTSW 7 35608460 missense possibly damaging 0.65
R6341:Ankrd27 UTSW 7 35627403 critical splice acceptor site probably null
R6721:Ankrd27 UTSW 7 35612551 missense probably damaging 1.00
R6860:Ankrd27 UTSW 7 35628527 missense possibly damaging 0.62
R7027:Ankrd27 UTSW 7 35612526 missense probably benign 0.00
R7231:Ankrd27 UTSW 7 35628446 missense possibly damaging 0.87
R7289:Ankrd27 UTSW 7 35631249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGGAGCCTTGGTCAAAC -3'
(R):5'- CTGGGGTGCTAATGTACATTTTCTC -3'

Sequencing Primer
(F):5'- TGGTCAAACCAGGGCATG -3'
(R):5'- ACATTTTCTCAGGAGGCCAG -3'
Posted On2019-06-26